NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586212           
Submitter
HandleSNP500CANCER
Submitter SNP IDPARP4-08
RefSNP(rs#)rs4986818
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleC/T
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG Codec/t_g
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 5
Genotype Summarypopulation count: 16
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: TATTTCACTTTTCAACCACG, Temp: 45.4, GC Content:35, Product Size: 363 Primer R: ACAGGATACAGTAGAGAAGATTTG, Temp: 46.2, GC Content:37.5

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586212|allelePos=197|len=424|taxid=9606|alleles='C/T'|mol=Genomic
 ATAAAAGAAA TAGGAACAAA GCAAAGGTTA GTACCTAAAA TATAAAACCT GTCAATTCAA
 TGGATATTGG TTTTCTGGTT TAAATTTCCA TTTAGAATTG TTTGAAATAA TTTCAGATAG
 AAATTTAAGA TYGTAGASTA AGACAACTTT CTCTTCATTT TTGCTAGCTT CTCTTTGACT
 ATGTCTATTG AGATGC
 Y
 GTAYGTGATT GAATTCATTT TCAGTGATAC WCATGAACTG AAACAAAAGG TTAGTGCATC
 TTTGATTTCT TAAGAGCTGT TATTTTAACA CTACTTTTAT CTTATCAAAG CAATGTATGC
 ACGTGGTTGA AAAGTGAAAT AATGCTGACA AAACTTCTAA CAAGAAGCAC TACTCCTGCC
 CCTGATTCTC CCCAGACCAG TTTCCAGAGA CAGTGAATCA TTTGGAC

  Submitted Frequency for ss5586212 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
PAC1
MULTI-NATIONAL
46C=1.00000000
T=0.00000000
C/C=1.00000000
C/T=0.00000000
08272003SNP500CANCER
AFR1
MULTI-NATIONAL
48C=0.97899997
T=0.02100000
0.041 +/-0.056C/C=0.95800000
C/T=0.04200000
0.04208272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62C=1.00000000
T=0.00000000
C/C=1.00000000
C/T=0.00000000
08272003SNP500CANCER
P1
MULTI-NATIONAL
202C=0.99500000
T=0.00500000
0.010 +/-0.014C/C=0.99000001
C/T=0.01000000
0.01008272003SNP500CANCER
HISP1
MULTI-NATIONAL
46C=1.00000000
T=0.00000000
C/C=1.00000000
C/T=0.00000000
08272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586212 back to top

Population ID
 -Class
Total
Sample
(2N)
Founder
(2N)
Major
Allele
Freq.
Minor
Allele
Freq.
Genotype
Freq.
HWE Goodness of FitData
Source
HapMap-CEU224224C=0.99107140
T=0.00892857C/C=0.98214287
C/T=0.01785714
Pr(chiSq=0.000,df=1)
=1.000
Genotype
Freq.
HapMap-HCB
EAST ASIA
8080C=0.97500002
T=0.02500000C/C=0.94999999
C/T=0.05000000
Pr(chiSq=0.001,df=1)
=1.000
Genotype
Freq.
HapMap-JPT164164C=0.97560978
T=0.02439024C/C=0.95121950
C/T=0.04878049
Pr(chiSq=0.002,df=1)
=1.000
Genotype
Freq.
HapMap-YRI120120C=0.99166667
T=0.00833333C/C=0.98333335
C/T=0.01666667
Pr(chiSq=0.000,df=1)
=1.000
Genotype
Freq.
HAPMAP-CHD170170C=0.99411762
T=0.00588235C/C=0.98823529
C/T=0.01176471
Pr(chiSq=0.000,df=1)
=1.000
Genotype
Freq.
HAPMAP-LWK176176C=0.99431819
T=0.00568182C/C=0.98863637
C/T=0.01136364
Pr(chiSq=0.000,df=1)
=1.000
Genotype
Freq.
HAPMAP-MEX9898C=0.96938777
T=0.03061225C/C=0.93877554
C/T=0.06122449
Pr(chiSq=0.003,df=1)
=1.000
Genotype
Freq.
HAPMAP-TSI172172C=0.99418604
T=0.00581395C/C=0.98837209
C/T=0.01162791
Pr(chiSq=0.000,df=1)
=1.000
Genotype
Freq.

  Submitted individual genotype for ss5586212 back to top
There is no individual genotype data for ss5586212.