NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586213           
Submitter
HandleSNP500CANCER
Submitter SNP IDPARP4-09
RefSNP(rs#)rs4986819
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleG/C
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG CodeUnknown
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 5
Genotype Summarypopulation count: 5
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: TATTTCACTTTTCAACCACG, Temp: 45.4, GC Content:35, Product Size: 363 Primer R: ACAGGATACAGTAGAGAAGATTTG, Temp: 46.2, GC Content:37.5
Platform: TaqMan Forward primer: AGAAAGTTGTCTTACTCTAC, Amount: 900 nM Reverse primer: AGAAAGTTGTCTTAGTCTAC, Amount: 900 nM Probe 1: CGGCATCTCAATAGACATAGTCAAAG, Amount: 200 nM Probe 2: TGGTTTTCTGGTTTAAATTTCCATTTAG, Amount: 200 nM Annealing temperature: 60 C

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586213|allelePos=144|len=325|taxid=9606|alleles='G/C'|mol=Genomic
 ATTTGTATAA AAGAAATAGG AACAAAGCAA AGGTTAGTAC CTAAAATATA AAACCTGTCA
 ATTCAATGGA TATTGGTTTT CTGGTTTAAA TTTCCATTTA GAATTGTTTG AAATAATTTC
 AGATAGAAAT TTAAGATYGT AGA
 S
 TAAGACAACT TTCTCTTCAT TTTTGCTAGC TTCTCTTTGA CTATGTCTAT TGAGATGCCG
 TATGTGATTG AATTCATTTT CAGTGATACA CATGAACTGA AACAAAAGGT TAGTGCATCT
 TTGATTTCTT AAGAGCTGTT ATTTTAACAC TACTTTTATC TTATCAAAGC AATGTATGCA
 C

  Submitted Frequency for ss5586213 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
PAC1
MULTI-NATIONAL
46C=1.00000000
G=0.00000000
C/C=1.00000000
C/G=0.00000000
G/G=0.00000000
08272003SNP500CANCER
AFR1
MULTI-NATIONAL
48C=0.66700000
G=0.33300000
0.444 +/-0.064C/C=0.45800000
C/G=0.41700000
G/G=0.12500000
0.41708272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62C=0.90300000
G=0.09700000
0.175 +/-0.086C/C=0.80599999
C/G=0.19400001
G/G=0.00000000
0.19408272003SNP500CANCER
P1
MULTI-NATIONAL
202C=0.88599998
G=0.11400000
0.202 +/-0.049C/C=0.80199999
C/G=0.16800000
G/G=0.03000000
0.16808272003SNP500CANCER
HISP1
MULTI-NATIONAL
46C=0.97799999
G=0.02200000
0.043 +/-0.058C/C=0.95700002
C/G=0.04300000
G/G=0.00000000
0.04308272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586213 back to top
No sufficient data to compute Hardy-weinberg probability for ss5586213.


  Submitted individual genotype for ss5586213 back to top
There is no individual genotype data for ss5586213.