NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586216           
Submitter
HandleSNP500CANCER
Submitter SNP IDPARP4-13
RefSNP(rs#)rs1050112
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleA/C
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG CodeUnknown
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 6
Genotype Summarypopulation count: 5
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: GCATCAAACTGTCTGGGAG, Temp: 47.4, GC Content:52.63, Product Size: 410 Primer R: TTAGCATCCTCTGAGTGGC, Temp: 47.4, GC Content:52.63
Platform: TaqMan Forward primer: AAGACAAGGAAGCAGGACTGTGA, Amount: 900 nM Reverse primer: CCTATCTTCCCCCGACT, Amount: 900 nM Probe 1: TGGCTCCGGCCGTTG, Amount: 200 nM Probe 2: TTCCTATCTTACCCCGACT, Amount: 200 nM Annealing temperature: 60 C

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586216|allelePos=212|len=449|taxid=9606|alleles='A/C'|mol=Genomic
 TTCTGAAGAT TTTGAAGAGG ATGSCTTAGG TGTACTACCA GCTTTCACAT CAAATTTGGA
 ACGTGGASGT GTGGAAAAGC TATTGGATTT AAGTTGGACA GAGTCATGTA AACCAACAGC
 AACTGAACCA CTATTTAAGA AAGTCAGTCC ATGGGAAACA TCTACTTCTA GCTTTTTTCC
 TATTTTGGCT CCGGCCGTTG GTTCCTATCT T
 M
 CCCCGACTRC CCGCGCTCAC AGTCCTGCTT CCTTGTCTTT TGCCTCATAT CGTCAGGTAG
 CTAGTTTCGG TTCAGCTGCT CCTCCCAGAC AGTTTGATGC ATCTCAATTC AGCCAAGGCC
 CTGTGCCTGG CACTTGTGCT GACTGGATCC CACAGTCGGC GTCTTGTCCC ACAGGACCTC
 CCCAGAACCC ACCTTCTTCA CCCTATTGTG GCATTGTTTT TTCAGGGAGC TCATTAA

  Submitted Frequency for ss5586216 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
CEPH
MULTI-NATIONAL
184A=0.50000000
C=0.50000000
0.500 +/-01_2004SEQUENOM
PAC1
MULTI-NATIONAL
48C=0.54200000
A=0.45800000
0.496 +/-0.017C/C=0.37500000
A/C=0.33300000
A/A=0.29200000
0.33308272003SNP500CANCER
AFR1
MULTI-NATIONAL
48C=0.52100003
A=0.47900000
0.499 +/-0.009A/C=0.37500000
C/C=0.33300000
A/A=0.29200000
0.37508272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62C=0.53200001
A=0.46799999
0.498 +/-0.011A/C=0.48400000
C/C=0.28999999
A/A=0.22600000
0.48408272003SNP500CANCER
P1
MULTI-NATIONAL
204C=0.55900002
A=0.44100001
0.493 +/-0.012A/C=0.41200000
C/C=0.35299999
A/A=0.23500000
0.41208272003SNP500CANCER
HISP1
MULTI-NATIONAL
46C=0.65200001
A=0.34799999
0.454 +/-0.060A/C=0.43500000
C/C=0.43500000
A/A=0.13000000
0.43508272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586216 back to top
No sufficient data to compute Hardy-weinberg probability for ss5586216.


  Submitted individual genotype for ss5586216 back to top
There is no individual genotype data for ss5586216.