NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586217           
Submitter
HandleSNP500CANCER
Submitter SNP IDPARP4-14
RefSNP(rs#)rs1050114
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleA/G
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG CodeUnknown
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 6
Genotype Summarypopulation count: 16
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: GCATCAAACTGTCTGGGAG, Temp: 47.4, GC Content:52.63, Product Size: 410 Primer R: TTAGCATCCTCTGAGTGGC, Temp: 47.4, GC Content:52.63
Platform: TaqMan Forward primer: AAGACAAGGAAGCAGGACTGTGA, Amount: 900 nM Reverse primer: CCGACTACCCGCGC, Amount: 900 nM Probe 1: CGACTGCCCGCGC, Amount: 200 nM Probe 2: CGGCCGTTGGTTCCTATCTT, Amount: 200 nM Annealing temperature: 60 C

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586217|allelePos=221|len=449|taxid=9606|alleles='A/G'|mol=Genomic
 TTCTGAAGAT TTTGAAGAGG ATGSCTTAGG TGTACTACCA GCTTTCACAT CAAATTTGGA
 ACGTGGASGT GTGGAAAAGC TATTGGATTT AAGTTGGACA GAGTCATGTA AACCAACAGC
 AACTGAACCA CTATTTAAGA AAGTCAGTCC ATGGGAAACA TCTACTTCTA GCTTTTTTCC
 TATTTTGGCT CCGGCCGTTG GTTCCTATCT TMCCCCGACT
 R
 CCCGCGCTCA CAGTCCTGCT TCCTTGTCTT TTGCCTCATA TCGTCAGGTA GCTAGTTTCG
 GTTCAGCTGC TCCTCCCAGA CAGTTTGATG CATCTCAATT CAGCCAAGGC CCTGTGCCTG
 GCACTTGTGC TGACTGGATC CCACAGTCGG CGTCTTGTCC CACAGGACCT CCCCAGAACC
 CACCTTCTTC ACCCTATTGT GGCATTGTTT TTTCAGGGAG CTCATTAA

  Submitted Frequency for ss5586217 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
CEPH
MULTI-NATIONAL
184G=0.94000000
A=0.06000000
0.113 +/-0.0441_2004SEQUENOM
PAC1
MULTI-NATIONAL
48G=1.00000000
A=0.00000000
G/G=1.00000000
A/A=0.00000000
A/G=0.00000000
08272003SNP500CANCER
AFR1
MULTI-NATIONAL
48G=0.83300000
A=0.16700000
0.278 +/-0.101G/G=0.70800000
A/G=0.25000000
A/A=0.04200000
0.25008272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62G=0.98400003
A=0.01600000
0.031 +/-0.044G/G=0.96799999
A/G=0.03200000
A/A=0.00000000
0.03208272003SNP500CANCER
P1
MULTI-NATIONAL
204G=0.94099998
A=0.05900000
0.111 +/-0.041G/G=0.89200002
A/G=0.09800000
A/A=0.01000000
0.09808272003SNP500CANCER
HISP1
MULTI-NATIONAL
46G=0.93500000
A=0.06500000
0.122 +/-0.089G/G=0.87000000
A/G=0.13000000
A/A=0.00000000
0.13008272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586217 back to top

Population ID
 -Class
Total
Sample
(2N)
Founder
(2N)
Major
Allele
Freq.
Minor
Allele
Freq.
Genotype
Freq.
HWE Goodness of FitData
Source
HapMap-CEU226226G=0.98672569
A=0.01327434G/G=0.97345132
A/G=0.02654867
Pr(chiSq=0.001,df=1)
=1.000
Genotype
Freq.
HapMap-YRI226226G=0.78761059
A=0.21238938G/G=0.60176992
A/G=0.37168142
A/A=0.02654867
Pr(chiSq=1.391,df=1)
=0.251
Genotype
Freq.
HAPMAP-ASW9696G=0.90625000
A=0.09375000G/G=0.81250000
A/G=0.18750000
Pr(chiSq=0.092,df=1)
=1.000
Genotype
Freq.
HAPMAP-LWK180180G=0.76111114
A=0.23888889G/G=0.56666666
A/G=0.38888890
A/A=0.04444445
Pr(chiSq=0.434,df=1)
=0.527
Genotype
Freq.
HAPMAP-MEX100100G=0.98000002
A=0.02000000G/G=0.95999998
A/G=0.04000000
Pr(chiSq=0.001,df=1)
=1.000
Genotype
Freq.
HAPMAP-MKK286286G=0.89160842
A=0.10839161G/G=0.79020977
A/G=0.20279720
A/A=0.00699301
Pr(chiSq=0.346,df=1)
=0.584
Genotype
Freq.
HAPMAP-TSI176176G=0.99431819
A=0.00568182G/G=0.98863637
A/G=0.01136364
Pr(chiSq=0.000,df=1)
=1.000
Genotype
Freq.

  Submitted individual genotype for ss5586217 back to top
There is no individual genotype data for ss5586217.