Submitter Handle SYSTEMSBIOZJU Submitter SNP ID SYSTEMSBIOZJU_SNV26838 RefSNP(rs#) rs1382708032 Submitted Batch ID Whole_Genome_Sequencing Submitted Date Jan 06, 2017 Publication Cited [1] Whole genome sequencing of matched tumor, adjacent non-tumor tissue and corresponding normal blood samples of hepatocellular carcinoma patients revealed a TP53 (R249S) mutation associated with poor prognosis First entry to dbSNP Jan 6 2017 12:00:00:000AM Resource Links Submitted Gene Name N.D Submitted Gene ID N.D. Submitted SNP Synonyms N.D Submitted linkout N.D Assay Species Homo sapiens Molecular Type Genomic Method RESEQ Ascertainment Samplesize 2 Population hepatocellular carcinoma patients Allele Observed Allele -/ACCACGAGCAGGCATGTCCT Ancestral Allele N.D. Allele Origin N/A SNP Class DIV CpG Code N.D. Validation Validation Status Not Validated HWE Goodness of Fit not applicable Variation Frequency Submission N.D. Genotype Summary N.D. Genotype Submission N.D. Haplotype N.D.   Fasta sequence   (Legend) >gnl|dbSNP|ss2137334796|allelePos=26|len=51|taxid=9606|alleles='-/ACCACGAGCAGGCATGTCCT'|mol=Genomic CACCACGAGC AGGCATGTCC TGGGC N GACAGGGGAA CACAGTCCCA GATGG   Submitted Frequency for ss2137334796 There is no frequency submission for ss2137334796.   dbSNP summary of Genotypes for ss2137334796 No sufficient data to compute Hardy-weinberg probability for ss2137334796.   Submitted individual genotype for ss2137334796 There is no individual genotype data for ss2137334796.

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement