Submitter | Handle | KOGIC | Submitter SNP ID | chr1:g.3042652_4 | RefSNP(rs#) | clustering in process | Submitted Batch ID | Korea1K | Submitted Date | Mar 02, 2020 | Publication Cited | [1] Korean Genome Project: 1,094 Korean personal genomes with clinical information | First entry to dbSNP | Mar 2 2020 12:00:00:000AM |
| Resource Links | Submitted Gene Name | N.D | Submitted Gene ID | N.D. | Submitted SNP Synonyms | N.D | Submitted linkout | N.D |
| | Allele | Observed Allele | -/GGCACGCACCACCGCACCCACATGCACCACCGCACCTG | Ancestral Allele | N.D. | Allele Origin | N/A | SNP Class | DIV | CpG Code | N.D. |
| Validation | Validation Status | Not Validated | HWE Goodness of Fit | not applicable | Homozygote Detected | | PCR Confirmed | | In Expressed Sequence | |
| Variation | Frequency Submission | N.D. | Genotype Summary | N.D. | Genotype Submission | N.D. | Haplotype | N.D. |
|
>gnl|dbSNP|ss3943675593|allelePos=26|len=51|taxid=9606|alleles='-/GGCACGCACCACCGCACCCACATGCACCACCGCACCTG'|mol=Genomic GCACCCGGCA CGCACCACCG CACCC
N
GCATGCACCA CCGCACCTGG CATGC
There is no frequency submission for ss3943675593.
No sufficient data to compute Hardy-weinberg probability for ss3943675593.
There is no individual genotype data for ss3943675593.
|