| Submitter | | Handle | GNOMAD | | Submitter SNP ID | v3_novel_783272 | | RefSNP(rs#) | clustering in process | | Submitted Batch ID | xaa.reformatted | | Submitted Date | Aug 29, 2020 | | Publication Cited | N.D. | | First entry to dbSNP | Aug 29 2020 12:00:00:000AM |
| | Resource Links | | Submitted Gene Name | N.D | | Submitted Gene ID | N.D. | | Submitted SNP Synonyms | N.D | | Submitted linkout | N.D |
| | Assay | | Species | Homo sapiens | Molecular
Type | Genomic | | Method | GNOMAD | | Ascertainment Samplesize | 143404 | | Population | N.D. |
| | Allele | | Observed Allele | -/AAGGGATGTAGGGAGGATGAAGGGATGATG | | Ancestral Allele | N.D. | | Allele Origin | N/A | | SNP Class | DIV | | CpG Code | N.D. |
| | Validation | | Validation Status | Not Validated | | HWE Goodness of Fit | not applicable | | Homozygote Detected | | | PCR Confirmed | | | In Expressed Sequence | |
| | Variation | | Frequency Submission | N.D. | | Genotype Summary | N.D. | | Genotype Submission | N.D. | | Haplotype | N.D. |
|
>gnl|dbSNP|ss3987672278|allelePos=26|len=51|taxid=9606|alleles='-/AAGGGATGTAGGGAGGATGAAGGGATGATG'|mol=Genomic AGGGATGATG AAGGGATGAT GGATA
N
GATAAAGGGA TATAGGGATG AAGCG
There is no frequency submission for ss3987672278.
No sufficient data to compute Hardy-weinberg probability for ss3987672278.
There is no individual genotype data for ss3987672278.
| 
