NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586208           
Submitter
HandleSNP500CANCER
Submitter SNP IDPARP4-01
RefSNP(rs#)rs13428
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleG/C
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG CodeUnknown
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 6
Genotype Summarypopulation count: 5
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: GCATCAAACTGTCTGGGAG, Temp: 47.4, GC Content:52.63, Product Size: 410 Primer R: TTAGCATCCTCTGAGTGGC, Temp: 47.4, GC Content:52.63
Platform: Sequencing Primer F: GGGAAGATAGGAACCAACGGC, Temp: 56.3, GC Content:57.14, Product Size: 415 Primer R: GATGGGTGGGAAGTCAAGTGC, Temp: 55.6, GC Content:57.14
Platform: TaqMan Forward primer: TTTCCACACcTCCACGTTCCAAATTT, Amount: 700 nM Reverse primer: TTTCCACACgTCCACGTTCCAAATT, Amount: 700 nM Probe 1: gactctgtccaacttaaatccaatagc, Amount: 100 nM Probe 2: tggaattatctcagccagaagtttc, Amount: 100 nM Annealing temperature: 64 C

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586208|allelePos=234|len=482|taxid=9606|alleles='G/C'|mol=Genomic
 GCTTGATTGT TCTTTTTATT CTGTGTTTTC CCCTTACGTT AATAATTCTG TCTTCTGGGC
 AGTCTCTTTT AGCATCCTCT GAGTGGCCAG AATTACGTTT ATCCAAACGA AAACATAGGA
 AAATTCCATT TTCCAAAAGA AAAATGGAAT TATCTCAGCC AGAAGTTTCT GAAGATTTTG
 AAGAGGATGS CTTAGGTGTA CTACCAGCTT TCACATCAAA TTTGGAACGT GGA
 S
 GTGTGGAAAA GCTATTGGAT TTAAGTTGGA CAGAGTCATG TAAACCAACA GCAACTGAAC
 CACTATTTAA GAAAGTCAGT CCATGGGAAA CATCTACTTC TAGCTTTTTT CCTATTTTGG
 CTCCGGCCGT TGGTTCCTAT CTTMCCCCGA CTRCCCGCGC TCACAGTCCT GCTTCCTTGT
 CTTTTGCCTC ATATCGTCAG GTAGCTAGTT TCGGTTCAGC TGCTCCTCCC AGACAGTTTG
 ATGCATCT

  Submitted Frequency for ss5586208 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
CEPH
MULTI-NATIONAL
184G=0.62000000
C=0.38000000
0.471 +/-0.0241_2004SEQUENOM
PAC1
MULTI-NATIONAL
48C=0.54200000
G=0.45800000
0.496 +/-0.017C/C=0.37500000
C/G=0.33300000
G/G=0.29200000
0.33308272003SNP500CANCER
AFR1
MULTI-NATIONAL
48C=0.52100003
G=0.47900000
0.499 +/-0.009C/G=0.37500000
C/C=0.33300000
G/G=0.29200000
0.37508272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62C=0.53200001
G=0.46799999
0.498 +/-0.011C/G=0.48400000
C/C=0.28999999
G/G=0.22600000
0.48408272003SNP500CANCER
P1
MULTI-NATIONAL
204C=0.55900002
G=0.44100001
0.493 +/-0.012C/G=0.41200000
C/C=0.35299999
G/G=0.23500000
0.41208272003SNP500CANCER
HISP1
MULTI-NATIONAL
46C=0.65200001
G=0.34799999
0.454 +/-0.060C/C=0.43500000
C/G=0.43500000
G/G=0.13000000
0.43508272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586208 back to top
No sufficient data to compute Hardy-weinberg probability for ss5586208.


  Submitted individual genotype for ss5586208 back to top
There is no individual genotype data for ss5586208.