NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss69809239           
Submitter
HandleTAPPERS
Submitter SNP IDCHRNB2X6b_Y332_C/T
RefSNP(rs#)rs4292956
Submitted Batch IDRDT2007April13
Submitted DateApr 13, 2007
Publication CitedN.D.
First entry to dbSNPApr 13 2007 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodRDT-DHPLC
Ascertainment Samplesize190
PopulationMOTWINS
Allele
Observed AlleleC/T
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG CodeN.D.
Validation
Validation StatusNot Validated
HWE Goodness of Fitnot applicable
Variation
Frequency SubmissionN.D.
Genotype SummaryN.D.
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
PCR reactions used genomic DNA; products were analyzed by DHPLC and sequencing, PCR primers were used to sequence both directions;PCR conditions for DHPLC are listed below:Forward primer: GGCTGCTCTCCATCTCTTGTReverse primer: TCACCCAAAGATTCAGAACTCATemplate: 165 ng genomic DNA in 18uL final reaction volumePrimer: each 0.3uM,dNTPs:each 0.125mM, Taq Polymerase: 0.05units/ulPCR buffer: 3.6ul (5x) home-made PCR buffer, 50mM KCl, 10mM Tris pH 8.3, Mg 1.5mM3 min 30s 94.5C initial denature and 10 min 72C final extension;40 cycles: 35s at 94.5C, 35s touchdown from 66C to 58C for the first 10 cycles, 35s at 58C for remaining 30 cycles, 35s at 72C

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss69809239|allelePos=51|len=101|taxid=9606|alleles='C/T'|mol=Genomic
 CGCTGCTTGA GTGGACAGCA GCTGGACTGG GTGGGCCCCA CAGTGGTCAG
 Y
 GATTCCTGCC AAGTAGGGTT TAGCCGGGCC CCATGGTCAC AGACCCCTGG

  Submitted Frequency for ss69809239 back to top
There is no frequency submission for ss69809239.


  dbSNP summary of Genotypes for ss69809239 back to top
No sufficient data to compute Hardy-weinberg probability for ss69809239.


  Submitted individual genotype for ss69809239 back to top
There is no individual genotype data for ss69809239.