NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:1000GENOMES
Submitter Batch ID:CEU_low_coverage_pilot_indel
Submitter Method ID:LOW_COVERAGE_PILOT_INDELS
Citation:A map of human genome variation from population-scale sequencing.SNP detection and genotyping from low coverage sequencing data on multiple diploid samples.Dindel: Accurate indel calls from short-read data.
Population:pilot_1_CEU_low_coverage_panel
Comment:not supplied
Batch Total SubSNP(ss) Count:728075


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss325997182 CEU_chr1_1000153_indel -/CACA 120 rs138701857 0 1 1074911 NT_032977.10 488923
ss325997183 CEU_chr1_1000906_indel -/A 120 rs149343181 0 1 1075664 NT_032977.10 489676
ss325997184 CEU_chr1_1000950_indel -/G 120 rs60561655 0 1 1075708 NT_032977.10 489720
ss325997185 CEU_chr1_1010786_indel -/G 120 rs70949550 0 1 1085543 NT_032977.10 499555
ss325997186 CEU_chr1_1026158_indel -/GGGGG 120 rs143916981 0 1 1100915 NT_032977.10 514927
ss325997187 CEU_chr1_1028860_indel -/CTC 120 rs71576598 0 1 1103618 NT_032977.10 517630
ss325997188 CEU_chr1_1040517_indel -/A 120 rs74912773 0 1 1115274 NT_032977.10 529286
ss325997189 CEU_chr1_1043690_indel -/G 120 rs5772037 0 1 1118447 NT_032977.10 532459
ss325997190 CEU_chr1_1049375_indel -/ACACACCTGAGCACACACACCTGTGC 120 rs151228715 0 1 1124132 NT_032977.10 538144
ss325997191 CEU_chr1_1055459_indel -/C 120 rs139209855 0 1 1130217 NT_032977.10 544229
ss325997192 CEU_chr1_1056251_indel -/T 120 rs34287831 1 1 1131008 NT_032977.10 545020
ss325997193 CEU_chr1_1057459_indel -/AG 120 rs141257782 0 1 1132217 NT_032977.10 546229
ss325997194 CEU_chr1_1057537_indel -/GG 120 rs35574593 1 1 1132294 NT_032977.10 546306
ss325997195 CEU_chr1_1058532_indel -/T 120 rs34990026 1 1 1133290 NT_032977.10 547302
ss325997196 CEU_chr1_1058695_indel -/GCCGCCTGCCTGCCCG 120 rs146603024 0 1 1133453 NT_032977.10 547465
ss325997197 CEU_chr1_1073880_indel -/C 120 rs141364850 0 1 1148637 NT_032977.10 562649
ss325997198 CEU_chr1_1087270_indel -/CCCA 120 rs145121017 0 1 1162028 NT_032977.10 576040
ss325997199 CEU_chr1_1088683_indel -/C 120 rs5772039 0 1 1163441 NT_032977.10 577453
ss325997200 CEU_chr1_1093553_indel -/CA 120 rs139946018 0 1 1168310 NT_032977.10 582322
ss325997201 CEU_chr1_1111698_indel -/TG 120 rs57346441 0 1 1186455 NT_032977.10 600467
ss325997202 CEU_chr1_1117471_indel -/T 120 rs138180324 0 1 1192228 NT_032977.10 606240
ss325997203 CEU_chr1_1118641_indel -/TTA 120 rs78174849 0 1 1193398 NT_032977.10 607410
ss325997204 CEU_chr1_1119225_indel -/C 120 rs60117456 0 1 1193982 NT_032977.10 607994
ss325997205 CEU_chr1_1121774_indel -/CTGTTCAGACCT 120 rs140480192 0 1 1196532 NT_032977.10 610544
ss325997206 CEU_chr1_1123178_indel -/AC 120 rs142789284 0 1 1197936 NT_032977.10 611948
ss325997207 CEU_chr1_1134362_indel -/GA 120 rs113462398 0 1 1209120 NT_032977.10 623132
ss325997208 CEU_chr1_1140087_indel -/C 120 rs148471100 0 1 1214845 NT_032977.10 628857
ss325997209 CEU_chr1_1141951_indel -/T 120 rs111818913 0 1 1216709 NT_032977.10 630721
ss325997210 CEU_chr1_1148304_indel -/CA 120 rs150930263 0 1 1223062 NT_032977.10 637074
ss325997211 CEU_chr1_1148425_indel -/AC 120 rs57524763 0 1 1223183 NT_032977.10 637195
30 of 728075 subsnp's starting at ss325997182. ss# starting at ss