NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:1000GENOMES
Submitter Batch ID:JPTCHB_low_coverage_pilot_indel
Submitter Method ID:LOW_COVERAGE_PILOT_INDELS
Citation:A map of human genome variation from population-scale sequencing.SNP detection and genotyping from low coverage sequencing data on multiple diploid samples.Dindel: Accurate indel calls from short-read data.
Population:pilot_1_CHB+JPT_low_coverage_panel
Comment:not supplied
Batch Total SubSNP(ss) Count:666639


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss325997437 JPTCHB_chr1_233713_indel -/AAGT 120 rs140116466 0 1 274100 NT_187170.1 16434
ss325997441 JPTCHB_chr1_719221_indel -/A 120 rs142251181 0 1 793979 NT_032977.10 207991
ss325997444 JPTCHB_chr1_759001_indel -/AT 120 rs59306077 0 1 833759 NT_032977.10 247771
ss325997447 JPTCHB_chr1_760175_indel -/ACCT 120 rs144794219 0 1 834932 NT_032977.10 248944
ss325997450 JPTCHB_chr1_764663_indel -/AC 120 rs143445210 0 1 839421 NT_032977.10 253433
ss325997453 JPTCHB_chr1_768165_indel -/CT 120 rs112119688 0 1 842922 NT_032977.10 256934
ss325997456 JPTCHB_chr1_769173_indel -/GA 120 rs80302052 0 1 843931 NT_032977.10 257943
ss325997459 JPTCHB_chr1_774544_indel -/GT 120 rs144673872 0 1 849301 NT_032977.10 263313
ss325997461 JPTCHB_chr1_780559_indel -/AT 120 rs76089329 0 1 855316 NT_032977.10 269328
ss325997463 JPTCHB_chr1_780621_indel -/TA 120 rs72558500 0 1 855379 NT_032977.10 269391
ss325997466 JPTCHB_chr1_786989_indel -/TAAT 120 rs140389426 0 1 861747 NT_032977.10 275759
ss325997469 JPTCHB_chr1_787239_indel -/GATA 120 rs149025072 0 1 861997 NT_032977.10 276009
ss325997472 JPTCHB_chr1_787397_indel -/GATAGAGA 120 rs142753025 0 1 862155 NT_032977.10 276167
ss325997475 JPTCHB_chr1_802796_indel -/CAT 120 rs141564386 0 1 877553 NT_032977.10 291565
ss325997478 JPTCHB_chr1_802991_indel -/AGCCCCCTGTGTACCCCAGGAGGCCAGA 120 rs144181751 0 1 877748 NT_032977.10 291760
ss325997486 JPTCHB_chr1_804691_indel -/A 120 rs140886673 0 1 879448 NT_032977.10 293460
ss325997489 JPTCHB_chr1_805647_indel -/TCTTTGC 120 rs141219483 0 1 880404 NT_032977.10 294416
ss325997492 JPTCHB_chr1_805957_indel -/G 120 rs149394883 0 1 880714 NT_032977.10 294726
ss325997495 JPTCHB_chr1_806275_indel -/T 120 rs143112172 0 1 881033 NT_032977.10 295045
ss325997498 JPTCHB_chr1_808204_indel -/C 120 rs145270046 0 1 882961 NT_032977.10 296973
ss325997501 JPTCHB_chr1_811467_indel -/GCCCTTTGGCAGAGCAGGTGTGCTGTGCTG 120 rs149920886 0 1 886224 NT_032977.10 300236
ss325997504 JPTCHB_chr1_822160_indel -/TG 120 rs34017275 1 1 896918 NT_032977.10 310930
ss325997507 JPTCHB_chr1_822823_indel -/T 120 rs34260203 1 1 897581 NT_032977.10 311593
ss325997510 JPTCHB_chr1_823035_indel -/CGAA 120 rs113551494 0 1 897792 NT_032977.10 311804
ss325997513 JPTCHB_chr1_827416_indel -/GTGT 120 rs112791300 0 1 902174 NT_032977.10 316186
ss325997516 JPTCHB_chr1_828192_indel -/C 120 rs144685080 0 1 902949 NT_032977.10 316961
ss325997519 JPTCHB_chr1_829759_indel -/GCCTCCTCCGAACGCGGCC 120 rs150560157 0 1 904517 NT_032977.10 318529
ss325997524 JPTCHB_chr1_831920_indel -/AACTCAGCTGCCTCTCCCCTTC 120 rs149865693 0 1 906677 NT_032977.10 320689
ss325997526 JPTCHB_chr1_831954_indel -/TCT 120 rs149056240 0 1 906711 NT_032977.10 320723
ss325997530 JPTCHB_chr1_832878_indel -/G 120 rs145118969 0 1 907635 NT_032977.10 321647
30 of 666639 subsnp's starting at ss325997437. ss# starting at ss