NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:LUNTER
Submitter Batch ID:indel_calls_from_1000_genomes_pilot_1_YRI
Submitter Method ID:ILLUMINA_SHORT_SEQUENCE_DATA
Citation:not supplied
Comment:not supplied
Batch Total SubSNP(ss) Count:1167719


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss550899108 YRI_1_45112-45113 -/TATGG 358 rs200769871 0 1 55249 NT_077402.3 45249
ss550899109 YRI_1_53599-53601 -/CTA 358 rs201888535 0 1 63736 NT_077402.3 53736
ss550899110 YRI_1_73808-73811 -/GAAA 358 rs368742622 0 1 83945 NT_077402.3 73945
ss550899111 YRI_1_73893-73894 -/A 358 rs372284318 0 1 84030 NT_077402.3 74030
ss550899112 YRI_1_81414-81415 -/T 358 rs375085441 0 1 91551 NT_077402.3 81551
ss550899113 YRI_1_522040-522041 -/CA 358 rs369803812 0 1 596797 NT_032977.10 10809
ss550899114 YRI_1_527404-527405 -/C 358 rs371559845 0 1 602161 NT_032977.10 16173
ss550899115 YRI_1_527524-527525 -/T 358 rs376294111 0 1 602281 NT_032977.10 16293
ss550899116 YRI_1_527583-527583 -/C 358 rs368975554 0 1 602340 NT_032977.10 16352
ss550899117 YRI_1_713602-713603 -/CT 358 rs59776264 0 1 788359 NT_032977.10 202371
ss550899118 YRI_1_713662-713663 -/AG 358 rs34882115 0 1 788419 NT_032977.10 202431
ss550899119 YRI_1_716989-716990 -/GT 358 rs369827241 0 1 791746 NT_032977.10 205758
ss550899120 YRI_1_724324-724324 -/G 358 rs374525459 0 1 799081 NT_032977.10 213093
ss550899121 YRI_1_742373-742373 -/A 358 rs372296167 0 1 817133 NT_032977.10 231145
ss550899122 YRI_1_743846-743847 -/T 358 rs371212353 0 1 818603 NT_032977.10 232615
ss550899123 YRI_1_749308-749311 -/TATT 358 rs78982110 0 1 824065 NT_032977.10 238077
ss550899124 YRI_1_750921-750937 -/CTGCTAGTACCTGCTGA 358 rs60637637 0 1 825678 NT_032977.10 239690
ss550899125 YRI_1_751243-751244 -/G 358 rs370137910 0 1 826000 NT_032977.10 240012
ss550899126 YRI_1_754948-754951 -/TTTG 358 rs201697576 0 1 829705 NT_032977.10 243717
ss550899127 YRI_1_759002-759003 -/AT 358 rs59306077 0 1 833759 NT_032977.10 247771
ss550899128 YRI_1_760175-760176 -/ACCT 358 rs144794219 0 1 834932 NT_032977.10 248944
ss550899129 YRI_1_762173-762174 -/TT 358 rs199975097 0 1 836930 NT_032977.10 250942
ss550899130 YRI_1_764664-764665 -/AC 358 rs143445210 0 1 839421 NT_032977.10 253433
ss550899131 YRI_1_768165-768166 -/CT 358 rs112119688 0 1 842922 NT_032977.10 256934
ss550899132 YRI_1_770211-770214 -/TTAA 358 rs202219272 0 1 844968 NT_032977.10 258980
ss550899133 YRI_1_770921-770921 -/C 358 rs60652745 0 1 845678 NT_032977.10 259690
ss550899134 YRI_1_776933-776934 -/AG 358 rs59146489 0 1 851690 NT_032977.10 265702
ss550899135 YRI_1_776946-776947 -/GGATACATCTTGCGTAATGA 358 rs376433631 0 1 851703 NT_032977.10 265715
ss550899136 YRI_1_779377-779377 -/A 358 rs200509509 0 1 854134 NT_032977.10 268146
ss550899137 YRI_1_780774-780777 -/TGTT 358 rs200103839 0 1 855531 NT_032977.10 269543
30 of 1167719 subsnp's starting at ss550899108. ss# starting at ss