NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:EVA_GENOME_DK
Submitter Batch ID:gatk
Submitter Method ID:ILLUMINA HISEQ 2500
Citation:not supplied
Population:DANISH PAN-GENOME
Comment:not supplied
Batch Total SubSNP(ss) Count:1238419


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss1573866481 EVA_GENOME_DK_gatk_indels_rs376342519 -/CGCCGTTGCAAAGGCGCGCCG 30 rs376342519 0 1 10617 NT_077402.3 617
ss1573866491 gatk.1:g12938gcaaa>g -/CAAA 30 rs756849893 0 1 12939 NT_077402.3 2939
ss1573866501 gatk.1:g13417c>cgaga -/GAGA 30 rs777038595 0 1 13417 NT_077402.3 3417
ss1573866506 EVA_GENOME_DK_gatk_indels_rs370886505 -/TGT 30 rs756427959 0 1 14398 NT_077402.3 4398
ss1573866510 gatk.1:g15219gagccacctccc>g -/AGCCACCTCCC 30 rs750100399 0 1 15220 NT_077402.3 5220
ss1573866818 gatk.1:g20862a>ag -/G 30 rs767517206 0 1 20862 NT_077402.3 10862
ss1573866822 gatk.1:g20913cagg>c -/AGG 30 rs753450800 0 1 20914 NT_077402.3 10914
ss1573866825 gatk.1:g21770tcccac>t -/CCCAC 30 rs747283974 0 1 21771 NT_077402.3 11771
ss1573866837 gatk.1:g28588g>gtttggt -/TTTGGT 30 rs760679436 0 1 28588 NT_077402.3 18588
ss1573866843 gatk.1:g28590t>ttgg -/TGG 30 rs757557694 0 1 28590 NT_077402.3 18590
ss1573866847 gatk.1:g29278gc>g -/C 30 rs780660371 0 1 29279 NT_077402.3 19279
ss1573866848 gatk.1:g51864c>ca -/A 30 rs749280879 0 1 51864 NT_077402.3 41864
ss1573866854 EVA_GENOME_DK_gatk_indels_rs199543075 -/AA 30 rs199543075 0 1 53139 NT_077402.3 43139
ss1573866856 gatk.1:g54753t>tttttctttctttctttctttcg -/TTTTCTTTCTTTCTTTCTTTCG 30 rs776659694 0 1 54753 NT_077402.3 44753
ss1573866955 EVA_GENOME_DK_gatk_indels_rs200769871 -/TATGG 30 rs200769871 0 1 55249 NT_077402.3 45249
ss1573866994 gatk.1:g61361at>a -/T 30 rs747496053 0 1 61362 NT_077402.3 51362
ss1573866997 gatk.1:g62297t>tcttc -/CTTC 30 rs544370662 0 1 62297 NT_077402.3 52297
ss1573867000 EVA_GENOME_DK_gatk_indels_rs201888535 -/CTA 30 rs201888535 0 1 63736 NT_077402.3 53736
ss1573867005 gatk.1:g64512tg>t -/G 30 rs574185548 0 1 64513 NT_077402.3 54513
ss1573867006 gatk.1:g70351ta>t -/A 30 rs528419934 0 1 70352 NT_077402.3 60352
ss1573867008 gatk.1:g71175ga>g -/A 30 rs753554581 0 1 71176 NT_077402.3 61176
ss1573867009 gatk.1:g75259cag>c -/AG 30 rs754638886 0 1 75260 NT_077402.3 65260
ss1573867013 gatk.1:g83631gt>g -/T 30 rs562973545 0 1 83632 NT_077402.3 73632
ss1573867015 gatk.1:g83786t>taaa -/AAA 30 rs769947886 0 1 83786 NT_077402.3 73786
ss1573867017 gatk.1:g83815gagaaagaaagaaagagaa>g -/AGAAAGAAAGAAAGAGAA 30 rs749502390 0 1 83816 NT_077402.3 73816
ss1573867070 EVA_GENOME_DK_gatk_indels_rs371757305 -/AGAA 30 rs371757305 0 1 83896 NT_077402.3 73896
ss1573867072 gatk.1:g83998g>gaaagaaagaaagaaaa -/AAAGAAAGAAAGAAAA 30 rs758683928 0 1 83998 NT_077402.3 73998
ss1573867079 gatk.1:g84001ag>a -/G 30 rs779535520 0 1 84002 NT_077402.3 74002
ss1573867081 gatk.1:g84003aaag>a -/AAG 30 rs768295300 0 1 84004 NT_077402.3 74004
ss1573867084 EVA_GENOME_DK_gatk_indels_rs202079949 -/G 30 rs202079949 0 1 84006 NT_077402.3 74006
30 of 1238419 subsnp's starting at ss1573866481. ss# starting at ss