NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:EVA_GENOME_DK
Submitter Batch ID:asmvar
Submitter Method ID:ILLUMINA HISEQ 2500
Citation:not supplied
Population:DANISH PAN-GENOME
Comment:not supplied
Batch Total SubSNP(ss) Count:119472


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss1575102524 asmvar.1:g15188ccgggcactgatgagacagcgg>c -/CGGGCACTGATGAGACAGCGG 30 rs768510816 0 1 15189 NT_077402.3 5189
ss1575102603 asmvar.1:g83829gagaaagaaagaa>g -/AGAAAGAAAGAA 30 rs746720693 0 1 83830 NT_077402.3 73830
ss1575102605 asmvar.1:g329259caaaaaaaaaaaaaa>c -/AAAAAAAAAAAAAA 30 rs780929253 0 1 490064 NT_077912.2 142096
ss1575102607 asmvar.1:g724173aatggaatggaa>ag ATGGAATGGAA/G 30 rs770273136 0 1 788794 NT_032977.10 202806
ss1575102767 asmvar.1:g774823acctagacacacact>a -/CCTAGACACACACT 30 rs756830244 0 1 839444 NT_032977.10 253456
ss1575102986 asmvar.1:g811215aactcccccat>a -/ACTCCCCCAT 30 rs566100889 0 1 875836 NT_032977.10 289848
ss1575102987 asmvar.1:g811296gctcctcccccacactctcccacactcccccacactcccccaca>g -/CTCCTCCCCCACACTCTCCCACACTCCCCCACACTCCCCCACA 30 rs778998594 0 1 875917 NT_032977.10 289929
ss1575102989 rs201930939 -/CCCACACTCC 30 rs201930939 0 1 876291 NT_032977.10 290303
ss1575102996 rs55706811 -/GCCCTTTGGCAGAGCAGGTGTGCTGTGCTG 30 rs149920886 0 1 886224 NT_032977.10 300236
ss1575102999 rs70949526 -/AAAAAAAAAAAAATATATATATATATATATATATAT 30 rs776659957 0 1 893790 NT_032977.10 307802
ss1575103001 asmvar.1:g834437.allele-1 GCTCTGTCACCCAGGCTGGAGTGCA/TTTTTTGTCCCCCCGGTTGGAG 30 rs746076435 0 1 899058 NT_032977.10 313070
ss1575103243 rs149865693 -/AACTCAGCTGCCTCTCCCCTTC 30 rs149865693 0 1 906677 NT_032977.10 320689
ss1575103246 rs138995446 -/CTGCCCGGTCCTTCTGACCAGCCGAGAGAGTA 30 rs138995446 0 1 907835 NT_032977.10 321847
ss1575103249 rs140295539 -/ACTGCCCAGCTC 30 rs140295539 0 1 914483 NT_032977.10 328495
ss1575103250 rs200313743 -/GAGCCGGCCCT 30 rs200313743 0 1 916632 NT_032977.10 330644
ss1575103253 asmvar.1:g860788ttggcgcctgcg>tc C/TGGCGCCTGCG 30 rs748488918 0 1 925409 NT_032977.10 339421
ss1575103499 rs79212057 -/CCCTGGAGGACC 30 rs6143081 1 1 939570 NT_032977.10 353582
ss1575103502 rs141837153 -/GCCAGTGGACGCCGACCT 30 rs141837153 0 1 939780 NT_032977.10 353792
ss1575103504 rs60085302 -/ACCCTGGTCCCCCTGGTCCCTTTGGCCCTGCACCTGGCTGG 30 rs775427240 0 1 948711 NT_032977.10 362723
ss1575103506 rs70949538 -/GAGTGTTTCGGGAGTTCTGGGTTGATTGTTTCTGGAGTTCAGGGTT 30 rs775169494 0 1 988819 NT_032977.10 402831
ss1575103508 asmvar.1:g928347gggagggtccatgtgtccgtcatctga>g -/GGAGGGTCCATGTGTCCGTCATCTGA 30 rs760413453 0 1 992968 NT_032977.10 406980
ss1575103797 asmvar.1:g930949tgatcctgcagatcactg>t -/GATCCTGCAGATCACTG 30 rs759224589 0 1 995570 NT_032977.10 409582
ss1575104004 rs58305877 -/GGGAGGGCAG 30 rs376071850 0 1 996254 NT_032977.10 410266
ss1575104007 rs61703480 -/GCCCCCGCAGCAGT 30 rs61703480 0 1 1005758 NT_032977.10 419770
ss1575104008 rs74203973 -/TTTTTTTTTTTTTTTTTTTTTTTT 30 rs750875528 0 1 1007747 NT_032977.10 421759
ss1575104010 rs141489152 -/TGTAGTCTGACCTGTGGTCTGAC 30 rs141489152 0 1 1022587 NT_032977.10 436599
ss1575104014 asmvar.1:g984158aaaaaaaaaaaagcag>agc AAAAAAAAAAAGCAG/GC 30 rs752786462 0 1 1048779 NT_032977.10 462791
ss1575104309 rs145846158 -/TCCCTCCCTTGTCCCCGTTCCCTCCG 30 rs145846158 0 1 1062057 NT_032977.10 476069
ss1575104311 asmvar.1:g1026784ggaagggcccacc>g -/GAAGGGCCCACC 30 rs575288753 0 1 1091405 NT_032977.10 505417
ss1575104312 asmvar.1:g1027086tggggctgtggtggagggtggggccaaatggaagtgggc>t -/GGGGCTGTGGTGGAGGGTGGGGCCAAATGGAAGTGGGC 30 rs746040566 0 1 1091707 NT_032977.10 505719
30 of 119472 subsnp's starting at ss1575102524. ss# starting at ss