NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:JJLAB
Submitter Batch ID:WHOLE GENOME INDELS DISCOVERY
Submitter Method ID:ILLUMINA HISEQ X TEN WHOLE GENOME SEQEUNCING
Citation:not supplied
Comment:not supplied
Batch Total SubSNP(ss) Count:1177966


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2019497445 INDEL1 -/C 96 rs112766696 0 1 10440 NT_077402.3 440
ss2030297668 INDEL2 -/CGCCGTTGCAAAGGCGCGCCG 96 rs376342519 0 1 10617 NT_077402.3 617
ss2030297669 INDEL3 -/C 96 rs201747181 0 1 13958 NT_077402.3 3958
ss2030297670 INDEL4 -/AA 96 rs199543075 0 1 53139 NT_077402.3 43139
ss2030297671 INDEL5 -/TATGG 96 rs200769871 0 1 55249 NT_077402.3 45249
ss2030297672 INDEL6 -/A 96 rs528419934 0 1 70352 NT_077402.3 60352
ss2030297673 INDEL7 -/G 96 rs779535520 0 1 84002 NT_077402.3 74002
ss2030297674 INDEL8 -/AAAGAAAGAAAGAA 96 rs879474653 0 1 84019 NT_077402.3 74019
ss2030297675 INDEL9 -/AAGAAAG 96 rs879896737 0 1 84024 NT_077402.3 74024
ss2030297676 INDEL10 -/T 96 rs567944403 0 1 94996 NT_077402.3 84996
ss2030297677 INDEL11 -/AAGTG 96 rs879704463 0 1 123815 NT_077402.3 113815
ss2030297678 INDEL12 -/A 96 rs879941791 0 1 135102 NT_077402.3 125102
ss2030297679 INDEL13 -/AA 96 rs879327469 0 1 261144 NT_187170.1 3478
ss2030297680 INDEL14 -/GT 96 rs200833524 0 1 261300 NT_187170.1 3634
ss2030297681 INDEL15 -/CT 96 rs202245468 0 1 263836 NT_187170.1 6170
ss2030297682 INDEL16 -/C 96 rs199948150 0 1 263935 NT_187170.1 6269
ss2030297683 INDEL17 -/TGTTT 96 rs776357423 0 1 273951 NT_187170.1 16285
ss2030297684 INDEL18 -/AGG 96 rs202029170 0 1 278166 NT_187170.1 20500
ss2030297685 INDEL19 -/C 96 rs72502741 0 1 281877 NT_187170.1 24211
ss2030297686 INDEL20 -/TC 96 rs199745078 0 1 286172 NT_187170.1 28506
ss2030297687 INDEL21 -/CAAT 96 rs879837939 0 1 596394 NT_032977.10 10406
ss2030297688 INDEL22 -/CGGGTGCCGTCTCAGCAGCTCACGGTGTGGAAACTGCGACACTCACG 96 rs879571278 0 1 598617 NT_032977.10 12629
ss2030297689 INDEL23 -/AG 96 rs781682554 0 1 598745 NT_032977.10 12757
ss2030297690 INDEL24 -/GG 96 rs777572056 0 1 601872 NT_032977.10 15884
ss2030297691 INDEL25 -/GA 96 rs759505956 0 1 605331 NT_032977.10 19343
ss2030297692 INDEL26 -/G 96 rs879616669 0 1 609321 NT_032977.10 23333
ss2030297693 INDEL27 -/A 96 rs879346974 0 1 612866 NT_032977.10 26878
ss2030297694 INDEL28 -/TTTAT 96 rs879500029 0 1 624616 NT_032977.10 38628
ss2030297695 INDEL29 -/G 96 rs879921095 0 1 732402 NT_032977.10 146414
ss2030297696 INDEL30 -/G 96 rs201221815 0 1 733015 NT_032977.10 147027
30 of 1177966 subsnp's starting at ss2019497445. ss# starting at ss