NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:TOPMED
Submitter Batch ID:topmed_chr1
Submitter Method ID:DATA FREEZE 3A
Citation:not supplied
Population:TOPMed public browser Oct 2016
Comment:not supplied
Batch Total SubSNP(ss) Count:13134694


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2136312822 1_10567_G/A A/G 29118 rs940697307 0 1 10567 NT_077402.3 567
ss2136312845 1_51973_GACGACGTTGTGTTGAA/G -/ACGACGTTGTGTTGAA 29118 rs1014103831 0 1 51974 NT_077402.3 41974
ss2136312846 1_102269_G/GAGCAAAAGCATCTGGAGA -/AGCAAAAGCATCTGGAGA 29118 rs1041543815 0 1 102269 NT_077402.3 92269
ss2136312847 1_121062_T/TTATATATTATATATGTATTA -/TATATATTATATATGTATTA 29118 rs59472517 0 1 121062 NT_077402.3 111062
ss2136312848 1_257085_CACTGGGGTCT/C -/ACTGGGGTCT 29118 rs999936953 0 1 287335 NT_187170.1 29669
ss2136312849 1_647436_TATATATCTATTATATATATAATATTATATATTATATATC/T -/ATATATCTATTATATATATAATATTATATATTATATATC 29118 rs1033148189 0 1 712057 NT_032977.10 126069
ss2136312850 1_706349_GCCAGTGACGTCAGGGGGCAGAGAGGCGCAGTTC/G -/CCAGTGACGTCAGGGGGCAGAGAGGCGCAGTTC 29118 rs963699400 0 1 770970 NT_032977.10 184982
ss2136312851 1_715460_GGCAATCCATTTCA/G -/GCAATCCATTTCA 29118 rs996429939 0 1 780081 NT_032977.10 194093
ss2136312852 1_724206_CGAATGGAATGGAACGGAACG/C -/GAATGGAATGGAACGGAACG 29118 rs1029210216 0 1 788827 NT_032977.10 202839
ss2136312853 1_724368_AATGGAATGGAATGGACTCAATTGG/A -/ATGGAATGGAATGGACTCAATTGG 29118 rs954953989 0 1 788989 NT_032977.10 203001
ss2136312854 1_725211_C/CGAATGGGATGGAATG -/GAATGGGATGGAATG 29118 rs988085990 0 1 789831 NT_032977.10 203843
ss2136312855 1_742206_CTAGAAAACAATAA/C -/TAGAAAACAATAA 29118 rs908019376 0 1 806827 NT_032977.10 220839
ss2136312856 1_756885_CGCTGTCTACACTACCT/C -/GCTGTCTACACTACCT 29118 rs962464765 0 1 821506 NT_032977.10 235518
ss2136312857 1_762982_CGGGGCGGGGTCTCGGGCA/C -/GGGGCGGGGTCTCGGGCA 29118 rs973524981 0 1 827603 NT_032977.10 241615
ss2136312858 1_768061_TGATGGTCATGGGCATAGGCAGGTTC/T -/GATGGTCATGGGCATAGGCAGGTTC 29118 rs920652110 0 1 832682 NT_032977.10 246694
ss2136312859 1_777293_AAGAAATGCTTCTTT/A -/AGAAATGCTTCTTT 29118 rs937325728 0 1 841914 NT_032977.10 255926
ss2136312860 1_788292_CCTCAGCCTCCTAA/C -/CTCAGCCTCCTAA 29118 rs991453941 0 1 852913 NT_032977.10 266925
ss2136312861 1_810063_ATGAACTTGGGGATGCCC/A -/TGAACTTGGGGATGCCC 29118 rs917204657 0 1 874684 NT_032977.10 288696
ss2136312862 1_812162_GCTTTTCCAGGCCT/G -/CTTTTCCAGGCCT 29118 rs949993524 0 1 876783 NT_032977.10 290795
ss2136312863 1_818719_T/TATATGTGCC -/ATATGTGCC 29118 rs1041964150 0 1 883339 NT_032977.10 297351
ss2136312864 1_840203_A/AGCCGCGCGGCCACGACG -/GCCGCGCGGCCACGACG 29118 rs903031008 0 1 904823 NT_032977.10 318835
ss2136312865 1_840588_CCTGTGCCCGA/C -/CTGTGCCCGA 29118 rs935809004 0 1 905209 NT_032977.10 319221
ss2136312866 1_844057_AAGGTGGGAGGGGAGAGGGGAGGGGATGGGGGAGGGAATGAGGGGAC/A -/AGGTGGGAGGGGAGAGGGGAGGGGATGGGGGAGGGAATGAGGGGAC 29118 rs1054136459 0 1 908678 NT_032977.10 322690
ss2136312867 1_856983_AGACACGGGTGTGAGCGAGTGGACACGG/A -/GACACGGGTGTGAGCGAGTGGACACGG 29118 rs899560064 0 1 921604 NT_032977.10 335616
ss2136312868 1_857067_GGTGTGGGAGTGGACACAGGT/G -/GTGTGGGAGTGGACACAGGT 29118 rs996505290 0 1 921688 NT_032977.10 335700
ss2136312869 1_857130_CACGGGTGTGTG/C -/ACGGGTGTGTG 29118 rs1029283616 0 1 921751 NT_032977.10 335763
ss2136312870 1_857817_ACACAGACTTCAGGAGAGGAAGG/A -/CACAGACTTCAGGAGAGGAAGG 29118 rs890733317 0 1 922438 NT_032977.10 336450
ss2136312871 1_858691_T/TCCCCACACCATG -/CCCCACACCATG 29118 rs749764182 0 1 923311 NT_032977.10 337323
ss2136312872 1_859953_CCGGCCGCCTCGCTGCCCGCCT/C -/CGGCCGCCTCGCTGCCCGCCT 29118 rs1015561329 0 1 924574 NT_032977.10 338586
ss2136312873 1_866328_ACCCGAGACAGGTC/A -/CCCGAGACAGGTC 29118 rs962252989 0 1 930949 NT_032977.10 344961
30 of 13134694 subsnp's starting at ss2136312822. ss# starting at ss