NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:TOPMED
Submitter Batch ID:topmed_chr10
Submitter Method ID:DATA FREEZE 3A
Citation:not supplied
Population:TOPMed public browser Oct 2016
Comment:not supplied
Batch Total SubSNP(ss) Count:7999036


all, sort by
SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2136342934 10_245234_ACTCCCTCCCTCTCTTCCTCC/A -/CTCCCTCCCTCTCTTCCTCC 29118 rs900711576 0 10 199295 NT_008705.17 189295
ss2136342935 10_287661_T/TGCTGGAGCTGCTG -/GCTGGAGCTGCTG 29118 rs932397955 0 10 241721 NT_008705.17 231721
ss2136342936 10_290846_AATACTCTTACAG/A -/ATACTCTTACAG 29118 rs1049966343 0 10 244907 NT_008705.17 234907
ss2136342937 10_293034_T/TAAAGTGCTCTGC -/AAAGTGCTCTGC 29118 rs893459718 0 10 247094 NT_008705.17 237094
ss2136342938 10_299773_G/GAAAAGCCTTTTA -/AAAAGCCTTTTA 29118 rs1011000296 0 10 253833 NT_008705.17 243833
ss2136342939 10_305266_CAGCTGAGACT/C -/AGCTGAGACT 29118 rs1042283330 0 10 259327 NT_008705.17 249327
ss2136342940 10_332448_CCACAGCCTCACAAT/C -/CACAGCCTCACAAT 29118 rs902434085 0 10 286509 NT_008705.17 276509
ss2136342941 10_334554_AGAAGGCAGAT/A -/GAAGGCAGAT 29118 rs1003343813 0 10 288615 NT_008705.17 278615
ss2136342942 10_335146_G/GGGACAGGGTGC -/GGACAGGGTGC 29118 rs1034844176 0 10 289206 NT_008705.17 279206
ss2136342943 10_347897_TGGTTTTCAAGTAGACTGCA/T -/GGTTTTCAAGTAGACTGCA 29118 rs959232747 0 10 301958 NT_008705.17 291958
ss2136342944 10_348629_CTGCACACCTGGACA/C -/TGCACACCTGGACA 29118 rs1012320550 0 10 302690 NT_008705.17 292690
ss2136342945 10_349106_C/CTTAAACACTGTACTCGTAA -/TTAAACACTGTACTCGTAA 29118 rs1028186605 0 10 303166 NT_008705.17 293166
ss2136312823 10_60143_G/A A/G 29118 N.D. N.D.
ss2136342917 10_60154_CTTTGAGTTCG/C -/TTTGAGTTCG 29118 N.D. N.D.
ss2136342918 10_68752_TATAGATATATATATAG/T -/ATAGATATATATATAG 29118 N.D. N.D.
ss2136342919 10_91477_CGAGTATGGGGGAGTGTGGGG/C -/GAGTATGGGGGAGTGTGGGG 29118 N.D. N.D.
ss2136342920 10_102746_ATCTCATATCCT/A -/TCTCATATCCT 29118 N.D. N.D.
ss2136342921 10_103462_GTACACTCACAGGCC/G -/TACACTCACAGGCC 29118 N.D. N.D.
ss2136342922 10_113082_GTTTTTTTGTTGTTTTTT/G -/TTTTTTTGTTGTTTTTT 29118 N.D. N.D.
ss2136342923 10_120174_G/GAATCTCTGGAA -/AATCTCTGGAA 29118 N.D. N.D.
ss2136342924 10_133046_T/TTATATGCATTCTC -/TATATGCATTCTC 29118 N.D. N.D.
ss2136342925 10_157397_GAAGAAGAAAAAGGAAAATA/G -/AAGAAGAAAAAGGAAAATA 29118 N.D. N.D.
ss2136342926 10_180583_C/CGTACTTCTCA -/GTACTTCTCA 29118 N.D. N.D.
ss2136342927 10_180984_CGGGCCGAGGGGCCGGTG/C -/GGGCCGAGGGGCCGGTG 29118 N.D. N.D.
ss2136342928 10_180993_GGGCCGGTGGGGCCGAGC/G -/GGCCGGTGGGGCCGAGC 29118 N.D. N.D.
ss2136342929 10_181333_GGGAGGAGGCCGGCAGGGAGGA/G -/GGAGGAGGCCGGCAGGGAGGA 29118 N.D. N.D.
ss2136342930 10_181676_TGGCGGGGCGGGCCGGGCC/T -/GGCGGGGCGGGCCGGGCC 29118 N.D. N.D.
ss2136342931 10_181693_CCGGCGGGGCCTGCGAGGGCGG/C -/CGGCGGGGCCTGCGAGGGCGG 29118 N.D. N.D.
ss2136342932 10_183142_CTGTCATATTCAGGG/C -/TGTCATATTCAGGG 29118 N.D. N.D.
ss2136342933 10_207131_AATCTCCCTGTAC/A -/ATCTCCCTGTAC 29118 N.D. N.D.
30 of 7999036 subsnp's starting at ss2136342934. ss# starting at ss