NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:TOPMED
Submitter Batch ID:topmed_chr13
Submitter Method ID:DATA FREEZE 3A
Citation:not supplied
Population:TOPMed public browser Oct 2016
Comment:not supplied
Batch Total SubSNP(ss) Count:5765087


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2136312826 13_19020107_A/T A/T 29118 rs1055664094 0 13 18445967 NT_024524.15 37861
ss2136374901 13_19053953_AATATACCAATATTTATATATTTAATATATATTAATATAATAT/A -/ATATACCAATATTTATATATTTAATATATATTAATATAATAT 29118 rs1038631876 0 13 18479814 NT_024524.15 71708
ss2136374902 13_19060225_TGGTAAATGTCCCCAA/T -/GGTAAATGTCCCCAA 29118 rs898395929 0 13 18486086 NT_024524.15 77980
ss2136374903 13_19142087_CATGGCCAAAGACCCCGAGAAGAGGGACG/C -/ATGGCCAAAGACCCCGAGAAGAGGGACG 29118 rs994077287 0 13 18567948 NT_024524.15 159842
ss2136374904 13_19174346_AGGGTCCTCCCACCCT/A -/GGGTCCTCCCACCCT 29118 rs1046709405 0 13 18600207 NT_024524.15 192101
ss2136374905 13_19174347_GGGTCCTCCCACCCTA/G -/GGTCCTCCCACCCTA 29118 rs890832344 0 13 18600208 NT_024524.15 192102
ss2136374906 13_19174409_CGGGCTCTGTGCGGGCGCT/C -/GGGCTCTGTGCGGGCGCT 29118 rs1007851440 0 13 18600270 NT_024524.15 192164
ss2136374907 13_19240084_CCAGGAGCAGGTCA/C -/CAGGAGCAGGTCA 29118 rs1017991457 0 13 18665945 NT_024524.15 257839
ss2136374908 13_19247426_CTCTCCCTCTCCCTCTCCT/C -/TCTCCCTCTCCCTCTCCT 29118 rs964148865 0 13 18673287 NT_024524.15 265181
ss2136374909 13_19254786_TGGCCGAGGCCG/T -/GGCCGAGGCCG 29118 rs1001022147 0 13 18680647 NT_024524.15 272541
ss2136374910 13_19259665_T/TTTATGTCAAGTGCAGCC -/TTATGTCAAGTGCAGCC 29118 rs1032951014 0 13 18685525 NT_024524.15 277419
ss2136374911 13_19279795_ACAGATTTTC/A -/CAGATTTTC 29118 rs956934442 0 13 18705656 NT_024524.15 297550
ss2136374912 13_19281974_ATCAGCTTTGCCCTTGGC/A -/TCAGCTTTGCCCTTGGC 29118 rs988431426 0 13 18707835 NT_024524.15 299729
ss2136374913 13_19287678_GAGTTTTTTTTCT/G -/AGTTTTTTTTCT 29118 rs918174219 0 13 18713539 NT_024524.15 305433
ss2136374914 13_19289422_ATGATCCTCTGTCTAC/A -/TGATCCTCTGTCTAC 29118 rs970680685 0 13 18715283 NT_024524.15 307177
ss2136374915 13_19300981_GCCCAGTGAGT/G -/CCCAGTGAGT 29118 rs980779712 0 13 18726842 NT_024524.15 318736
ss2136374916 13_19309118_TTCTTTTCTTAAAAAATGGTATAAAATGACA/T -/TCTTTTCTTAAAAAATGGTATAAAATGACA 29118 rs926706779 0 13 18734979 NT_024524.15 326873
ss2136374917 13_19318108_T/TCATGGAGGTGC -/CATGGAGGTGC 29118 rs942135305 0 13 18743968 NT_024524.15 335862
ss2136374918 13_19322484_AGTAAAAGTTTCCCATGAG/A -/GTAAAAGTTTCCCATGAG 29118 rs1038195104 0 13 18748345 NT_024524.15 340239
ss2136374919 13_19356650_ACCCTGATCC/A -/CCCTGATCC 29118 rs919791098 0 13 18782511 NT_024524.15 374405
ss2136374920 13_19389583_ATGTTGACCAGGCTGGTC/A -/TGTTGACCAGGCTGGTC 29118 rs929893683 0 13 18815444 NT_024524.15 407338
ss2136374921 13_19392759_TCAGCAGTATCAAAA/T -/CAGCAGTATCAAAA 29118 rs1046925868 0 13 18818620 NT_024524.15 410514
ss2136374922 13_19398031_TAAAAATTAACTC/T -/AAAAATTAACTC 29118 rs891050766 0 13 18823892 NT_024524.15 415786
ss2136374923 13_19419671_TAAGAATTACTAGAATAATGAATAAGTTACTAGAGATAGTA/T -/AAGAATTACTAGAATAATGAATAAGTTACTAGAGATAGTA 29118 rs1007821767 0 13 18845532 NT_024524.15 437426
ss2136374924 13_19442655_GTTAGGAAGATGTAATAAGA/G -/TTAGGAAGATGTAATAAGA 29118 rs1039799276 0 13 18868516 NT_024524.15 460410
ss2136374925 13_19457001_GTGTGTATTTGACAAGCC/G -/TGTGTATTTGACAAGCC 29118 rs899566965 0 13 18882862 NT_024524.15 474756
ss2136374926 13_19463540_TTTCATTTTATTTTA/T -/TTCATTTTATTTTA 29118 rs1001056237 0 13 18889401 NT_024524.15 481295
ss2136374927 13_19468519_TCAGGGGTACTGGCTGGG/T -/CAGGGGTACTGGCTGGG 29118 rs1032508697 0 13 18894380 NT_024524.15 486274
ss2136374928 13_19501240_GTGGAGTTCTCGTGAA/G -/TGGAGTTCTCGTGAA 29118 rs956817504 0 13 18927101 NT_024524.15 518995
ss2136374929 13_19514609_AGATAACTTTAT/A -/GATAACTTTAT 29118 rs1009744196 0 13 18940470 NT_024524.15 532364
30 of 5765087 subsnp's starting at ss2136312826. ss# starting at ss