NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:TOPMED
Submitter Batch ID:topmed_chr15
Submitter Method ID:DATA FREEZE 3A
Citation:not supplied
Population:TOPMed public browser Oct 2016
Comment:not supplied
Batch Total SubSNP(ss) Count:4677184


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2136312828 15_20000011_G/A A/G 29118 rs111217820 0 15 19794758 NT_037852.7 19504
ss2136389580 15_20027721_T/TGCCTCCGTGA -/GCCTCCGTGA 29118 rs1024611484 0 15 19822468 NT_037852.7 47214
ss2136389581 15_20033509_ACAAAAAGAGTGTTTCAAAACTGCTCAATCGAAAGTAAGGTT/A -/CAAAAAGAGTGTTTCAAAACTGCTCAATCGAAAGTAAGGTT 29118 rs970983443 0 15 19828257 NT_037852.7 53003
ss2136389582 15_20038321_CTTCAAAAAGAGTGT/C -/TTCAAAAAGAGTGT 29118 rs981433277 0 15 19833069 NT_037852.7 57815
ss2136389583 15_20045210_TATGCCTTGTGA/T -/ATGCCTTGTGA 29118 rs1033819479 0 15 19839958 NT_037852.7 64704
ss2136389584 15_20056251_CCCCCAGAGTT/C -/CCCCAGAGTT 29118 rs963873391 0 15 19850999 NT_037852.7 75745
ss2136389585 15_20104284_TGCTTTTTGCCCCCGCCTCCGCGGCTTTTTGCCTCCCCG/T -/GCTTTTTGCCCCCGCCTCCGCGGCTTTTTGCCTCCCCG 29118 rs973607956 0 15 19899032 NT_037852.7 123778
ss2136389586 15_20104304_GCGGCTTTTTGCCTCCC/G -/CGGCTTTTTGCCTCCC 29118 rs919326543 0 15 19899052 NT_037852.7 123798
ss2136389587 15_20104323_GCTTTTTGCCCCCGCCGCCGCGA/G -/CTTTTTGCCCCCGCCGCCGCGA 29118 rs929388040 0 15 19899071 NT_037852.7 123817
ss2136389588 15_20104341_C/CGCGACTTTTTCCCCGCT -/GCGACTTTTTCCCCGCT 29118 rs987445416 0 15 19899088 NT_037852.7 123834
ss2136389589 15_20104390_CTTTTTGTCCCCGCCACCGAGGA/C -/TTTTTGTCCCCGCCACCGAGGA 29118 rs911883550 0 15 19899138 NT_037852.7 123884
ss2136389590 15_20107614_GATGAAATGATGAAATGAAGAA/G -/ATGAAATGATGAAATGAAGAA 29118 rs943932902 0 15 19902362 NT_037852.7 127108
ss2136389591 15_20107766_TTGAAATAATGAAATGAAATGA/T -/TGAAATAATGAAATGAAATGA 29118 rs1040017071 0 15 19902514 NT_037852.7 127260
ss2136389592 15_20107785_TGATGAAATGATGAAATGAAATGAAAA/T -/GATGAAATGATGAAATGAAATGAAAA 29118 rs899785637 0 15 19902533 NT_037852.7 127279
ss2136389593 15_20107855_AAATGATGAAATGAAGTG/A -/AATGATGAAATGAAGTG 29118 rs936488322 0 15 19902603 NT_037852.7 127349
ss2136389594 15_20107876_GATGAAATGATGAAATAATGAA/G -/ATGAAATGATGAAATAATGAA 29118 rs1053580106 0 15 19902624 NT_037852.7 127370
ss2136389595 15_20108069_GTGAAATGATGAAA/G -/TGAAATGATGAAA 29118 rs892188343 0 15 19902817 NT_037852.7 127563
ss2136389596 15_20108325_ATGATGAAATGATGAAT/A -/TGATGAAATGATGAAT 29118 rs1009292181 0 15 19903073 NT_037852.7 127819
ss2136389597 15_20108834_AATGAAATGATGAAATG/A -/ATGAAATGATGAAATG 29118 rs1024560397 0 15 19903582 NT_037852.7 128328
ss2136389598 15_20108880_AAATGAAATGAAAC/A -/AATGAAATGAAAC 29118 rs906199039 0 15 19903628 NT_037852.7 128374
ss2136389599 15_20108965_TGATGAAATGATGAGATGAAAA/T -/GATGAAATGATGAGATGAAAA 29118 rs1001912095 0 15 19903713 NT_037852.7 128459
ss2136389600 15_20108985_AAGATGAAATGATG/A -/AGATGAAATGATG 29118 rs1034345217 0 15 19903733 NT_037852.7 128479
ss2136389601 15_20109075_GATGAAATGAAATGAAAGA/G -/ATGAAATGAAATGAAAGA 29118 rs963689544 0 15 19903823 NT_037852.7 128569
ss2136389602 15_20121657_CTGTGGGGCCAG/C -/TGTGGGGCCAG 29118 rs973538875 0 15 19916405 NT_037852.7 141151
ss2136389603 15_20121797_ACAGGTAATCC/A -/CAGGTAATCC 29118 rs1026502245 0 15 19916545 NT_037852.7 141291
ss2136389604 15_20123008_CTAGCAAAGAAA/C -/TAGCAAAGAAA 29118 rs950739044 0 15 19917756 NT_037852.7 142502
ss2136389605 15_20131542_ATCCAGACACACGATGCG/A -/TCCAGACACACGATGCG 29118 rs987558558 0 15 19926290 NT_037852.7 151036
ss2136389606 15_20139314_ATTAGTAGGATGT/A -/TTAGTAGGATGT 29118 rs912012814 0 15 19934062 NT_037852.7 158808
ss2136389607 15_20148925_CCCCACCGCCGCCGCGGCTTTTTGCT/C -/CCCACCGCCGCCGCGGCTTTTTGCT 29118 rs943360260 0 15 19943673 NT_037852.7 168419
ss2136389608 15_20149164_CCCCGCCGTGGCTTTT/C -/CCCGCCGTGGCTTTT 29118 rs974793698 0 15 19943912 NT_037852.7 168658
30 of 4677184 subsnp's starting at ss2136312828. ss# starting at ss