NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:TOPMED
Submitter Batch ID:topmed_chr16
Submitter Method ID:DATA FREEZE 3A
Citation:not supplied
Population:TOPMed public browser Oct 2016
Comment:not supplied
Batch Total SubSNP(ss) Count:5307949


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2136312829 16_60029_C/G C/G 29118 rs1020455733 0 16 10029 NT_010393.17 29
ss2136396545 16_73396_TTTTTTTTTTTTTTTTTTTTTTTGGAG/T -/TTTTTTTTTTTTTTTTTTTTTTGGAG 29118 rs904622487 0 16 23397 NT_010393.17 13397
ss2136396546 16_82766_GGAGGGTCCTTGTCCATCTTGTTCTCTAAGGCATCGGCCAGGGTGAGAA/G -/GAGGGTCCTTGTCCATCTTGTTCTCTAAGGCATCGGCCAGGGTGAGAA 29118 rs1000121399 0 16 32767 NT_010393.17 22767
ss2136396547 16_88921_GAGGCACCACTCAGCACATGCCCCAGCAGA/G -/AGGCACCACTCAGCACATGCCCCAGCAGA 29118 rs1053077556 0 16 38922 NT_010393.17 28922
ss2136396548 16_91142_TAGTGAGCCTTA/T -/AGTGAGCCTTA 29118 rs892364714 0 16 41143 NT_010393.17 31143
ss2136396549 16_92826_TGGCCAAGGAAGA/T -/GGCCAAGGAAGA 29118 rs1009478533 0 16 42827 NT_010393.17 32827
ss2136396550 16_94591_GGAGGCTGATCA/G -/GAGGCTGATCA 29118 rs1025220976 0 16 44592 NT_010393.17 34592
ss2136396551 16_105740_ACCATGGATCTTCTC/A -/CCATGGATCTTCTC 29118 rs970552566 0 16 55741 NT_010393.17 45741
ss2136396552 16_106001_AAGTGATGAGCTCCCTGTCACAAG/A -/AGTGATGAGCTCCCTGTCACAAG 29118 rs1002465878 0 16 56002 NT_010393.17 46002
ss2136396553 16_134741_GCTTTGTCAGCCTCCTCCTGCC/G -/CTTTGTCAGCCTCCTCCTGCC 29118 rs1033407236 0 16 84743 NT_010393.17 74743
ss2136396554 16_136629_CGGGGGGAGCCCTGG/C -/GGGGGGAGCCCTGG 29118 rs963154371 0 16 86631 NT_010393.17 76631
ss2136396555 16_139302_G/GCCTGGGGACCGGGGA -/CCTGGGGACCGGGGA 29118 rs973048237 0 16 89304 NT_010393.17 79304
ss2136396556 16_147157_C/CACGGGACCAT -/ACGGGACCAT 29118 rs918966664 0 16 97159 NT_010393.17 87159
ss2136396557 16_148368_CTGCACCAGGTA/C -/TGCACCAGGTA 29118 rs950938690 0 16 98371 NT_010393.17 88371
ss2136396558 16_148390_ATGCACCAGGTCC/A -/TGCACCAGGTCC 29118 rs987709291 0 16 98393 NT_010393.17 88393
ss2136396559 16_148402_CTGCACCAGGTATGCACCGGGTA/C -/TGCACCAGGTATGCACCGGGTA 29118 rs912136100 0 16 98405 NT_010393.17 88405
ss2136396560 16_148482_CTGCACCAGGTA/C -/TGCACCAGGTA 29118 rs943524875 0 16 98485 NT_010393.17 88485
ss2136396561 16_148499_C/CAGGTCCTGCACG -/AGGTCCTGCACG 29118 rs1039621209 0 16 98501 NT_010393.17 88501
ss2136396562 16_148499_CAGGTCCTGCACG/C -/AGGTCCTGCACG 29118 rs926024987 0 16 98502 NT_010393.17 88502
ss2136396563 16_152365_ACAGGGGGGAT/A -/CAGGGGGGAT 29118 rs936109192 0 16 102368 NT_010393.17 92368
ss2136396564 16_163577_GGGTCTGTGAAAACA/G -/GGTCTGTGAAAACA 29118 rs1053043959 0 16 113579 NT_010393.17 103579
ss2136396565 16_168877_AAGCCACACCTGCCCAGGGGG/A -/AGCCACACCTGCCCAGGGGG 29118 rs891831018 0 16 118879 NT_010393.17 108879
ss2136396566 16_168924_CCTGCCCAGGGGAAGCCACAT/C -/CTGCCCAGGGGAAGCCACAT 29118 rs1014216845 0 16 118926 NT_010393.17 108926
ss2136396567 16_188736_G/GGCGCAGGCAGCGGAAT -/GCGCAGGCAGCGGAAT 29118 rs1046271840 0 16 138737 NT_010393.17 128737
ss2136396568 16_201446_TGGGCAAAACA/T -/GGGCAAAACA 29118 rs906455787 0 16 151448 NT_010393.17 141448
ss2136396569 16_203222_GAGGACAGATAGCGTTCCCTCTCAGTGAGGAGAGCAGGGTA/G -/AGGACAGATAGCGTTCCCTCTCAGTGAGGAGAGCAGGGTA 29118 rs1002031558 0 16 153224 NT_010393.17 143224
ss2136396570 16_216964_ACTTCAACCCTTGAATCGGG/A -/CTTCAACCCTTGAATCGGG 29118 rs1033955543 0 16 166966 NT_010393.17 156966
ss2136396571 16_227248_G/GCCCTCGGCCCCACTGA -/CCCTCGGCCCCACTGA 29118 rs963122008 0 16 177249 NT_010393.17 167249
ss2136396572 16_228132_TGGGCCCAGCTCA/T -/GGGCCCAGCTCA 29118 rs994624659 0 16 178134 NT_010393.17 168134
ss2136396573 16_231815_GAACTTCCGAA/G -/AACTTCCGAA 29118 rs1026079458 0 16 181817 NT_010393.17 171817
30 of 5307949 subsnp's starting at ss2136312829. ss# starting at ss