NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:TOPMED
Submitter Batch ID:topmed_chr18
Submitter Method ID:DATA FREEZE 3A
Citation:not supplied
Population:TOPMed public browser Oct 2016
Comment:not supplied
Batch Total SubSNP(ss) Count:4557660


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2136312831 18_10891_G/A A/G 29118 rs1000302366 0 18 10891 NT_010859.15 891
ss2136412817 18_37439_GACTAACAGCTGATCTCTCA/G -/ACTAACAGCTGATCTCTCA 29118 rs1050073618 0 18 37440 NT_010859.15 27440
ss2136412818 18_47573_CTGCTCTGAGACACA/C -/TGCTCTGAGACACA 29118 rs888795478 0 18 47574 NT_010859.15 37574
ss2136412819 18_48896_GCCCTGGCTAAGGAGCCGCAC/G -/CCCTGGCTAAGGAGCCGCAC 29118 rs1011305203 0 18 48897 NT_010859.15 38897
ss2136412820 18_48910_GCCGCACCCCAGTCCTCGC/G -/CCGCACCCCAGTCCTCGC 29118 rs1042818176 0 18 48911 NT_010859.15 38911
ss2136412821 18_63656_AGCCCTAGCCTT/A -/GCCCTAGCCTT 29118 rs902983076 0 18 63657 NT_010859.15 53657
ss2136412822 18_82188_CAGGCAGAGCAGGAGCCCAG/C -/AGGCAGAGCAGGAGCCCAG 29118 rs998693402 0 18 82189 NT_010859.15 72189
ss2136412823 18_94593_GCTAACCCTAACCCTAACCCCTAAAA/G -/CTAACCCTAACCCTAACCCCTAAAA 29118 rs1035973944 0 18 94594 NT_010859.15 84594
ss2136412824 18_98484_TCTCTTAAGAATGTC/T -/CTCTTAAGAATGTC 29118 rs959930988 0 18 98485 NT_010859.15 88485
ss2136412825 18_102854_GTGAAGTTTGGAGAA/G -/TGAAGTTTGGAGAA 29118 rs1012815106 0 18 102855 NT_010859.15 92855
ss2136412826 18_116422_ATCTATGTGCAGGT/A -/TCTATGTGCAGGT 29118 rs1023563812 0 18 116423 NT_010859.15 106423
ss2136412827 18_131076_GACCTGCCCCCATGATTCAACT/G -/ACCTGCCCCCATGATTCAACT 29118 rs969379803 0 18 131077 NT_010859.15 121077
ss2136412828 18_142034_AACACACACACACACACAGACACGCACACAC/A -/ACACACACACACACACAGACACGCACACAC 29118 rs985245621 0 18 142035 NT_010859.15 132035
ss2136412829 18_156304_TCACTTCATTGCC/T -/CACTTCATTGCC 29118 rs1016341465 0 18 156305 NT_010859.15 146305
ss2136412830 18_171268_A/AAGCCTTTCAT -/AGCCTTTCAT 29118 rs962476437 0 18 171268 NT_010859.15 161268
ss2136412831 18_174729_TGAGTAGTTGG/T -/GAGTAGTTGG 29118 rs972239483 0 18 174730 NT_010859.15 164730
ss2136412832 18_175988_GGTTCATTTAA/G -/GTTCATTTAA 29118 rs923461317 0 18 175989 NT_010859.15 165989
ss2136412833 18_177526_ATAAAGGTCAT/A -/TAAAGGTCAT 29118 rs933528918 0 18 177527 NT_010859.15 167527
ss2136412834 18_179367_GTATTTACTATTAC/G -/TATTTACTATTAC 29118 rs986397941 0 18 179368 NT_010859.15 169368
ss2136412835 18_187832_TTGAAAACACATTTATTTACCC/T -/TGAAAACACATTTATTTACCC 29118 rs910182551 0 18 187833 NT_010859.15 177833
ss2136412836 18_188863_GAGACGTGGTTTC/G -/AGACGTGGTTTC 29118 rs947083018 0 18 188864 NT_010859.15 178864
ss2136412837 18_213975_T/TTAGATAGATTAGA -/TAGATAGATTAGA 29118 rs58838924 0 18 213975 NT_010859.15 203975
ss2136412838 18_214011_TGATGATTGATA/T -/GATGATTGATA 29118 rs902931518 0 18 214012 NT_010859.15 204012
ss2136412839 18_217205_CTTATAAATAAGCATATG/C -/TTATAAATAAGCATATG 29118 rs934430102 0 18 217206 NT_010859.15 207206
ss2136412840 18_232295_ACTTTGTTGCTCAGG/A -/CTTTGTTGCTCAGG 29118 rs1056882932 0 18 232296 NT_010859.15 222296
ss2136412841 18_249755_T/TCATGAATGTAATAATGAATA -/CATGAATGTAATAATGAATA 29118 rs895666349 0 18 249755 NT_010859.15 239755
ss2136412842 18_274058_TGCGGATTGAA/T -/GCGGATTGAA 29118 rs1012762693 0 18 274059 NT_010859.15 264059
ss2136412843 18_274240_GTGGAGCGTGATT/G -/TGGAGCGTGATT 29118 rs1022843799 0 18 274241 NT_010859.15 264241
ss2136412844 18_282917_CTGAGGCGGAAGGACACT/C -/TGAGGCGGAAGGACACT 29118 rs888397683 0 18 282918 NT_010859.15 272918
ss2136412845 18_284950_ACGCAAAGTTCATTTAC/A -/CGCAAAGTTCATTTAC 29118 rs1006218180 0 18 284951 NT_010859.15 274951
30 of 4557660 subsnp's starting at ss2136312831. ss# starting at ss