NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:TOPMED
Submitter Batch ID:topmed_chr2
Submitter Method ID:DATA FREEZE 3A
Citation:not supplied
Population:TOPMed public browser Oct 2016
Comment:not supplied
Batch Total SubSNP(ss) Count:14434003


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2136312833 2_10275_C/A A/C 29118 rs533610139 0 2 10275 NT_005334.17 275
ss2136426087 2_20805_ATCACTCAAATTTTGATAATTATAT/A -/TCACTCAAATTTTGATAATTATAT 29118 rs991855186 0 2 20806 NT_005334.17 10806
ss2136426088 2_46306_TCGGGGTCCCGGGTAGCCG/T -/CGGGGTCCCGGGTAGCCG 29118 rs916232930 0 2 46307 NT_005334.17 36307
ss2136426089 2_54867_CAAGCCCACAGGAAAA/C -/AAGCCCACAGGAAAA 29118 rs947835662 0 2 54868 NT_005334.17 44868
ss2136426090 2_60948_CAATTCAGGAAAACA/C -/AATTCAGGAAAACA 29118 rs984549932 0 2 60949 NT_005334.17 50949
ss2136426091 2_63097_TCATTATAAATGTGACA/T -/CATTATAAATGTGACA 29118 rs909046837 0 2 63098 NT_005334.17 53098
ss2136426092 2_84790_TGAGGTCTTACAGCCAAA/T -/GAGGTCTTACAGCCAAA 29118 rs940497047 0 2 84791 NT_005334.17 74791
ss2136426093 2_97506_CAAAATCTCCTT/C -/AAAATCTCCTT 29118 rs1036250132 0 2 97507 NT_005334.17 87507
ss2136426094 2_104657_CAAGCTGCTATTATTTTGTTGA/C -/AAGCTGCTATTATTTTGTTGA 29118 rs901796095 0 2 104658 NT_005334.17 94658
ss2136426095 2_120101_AGTTCATTTTAC/A -/GTTCATTTTAC 29118 rs933219447 0 2 120102 NT_005334.17 110102
ss2136426096 2_216814_TTATTCTGCTTGTTCATAG/T -/TATTCTGCTTGTTCATAG 29118 rs1051083943 0 2 216815 NT_005334.17 206815
ss2136426097 2_223071_TAACTCAGTTGTAACTG/T -/AACTCAGTTGTAACTG 29118 rs889774296 0 2 223072 NT_005334.17 213072
ss2136426098 2_241862_A/ACTTAAAAAAC -/CTTAAAAAAC 29118 rs1007392449 0 2 241862 NT_005334.17 231862
ss2136426099 2_288134_CGCCCGCCCGCCA/C -/GCCCGCCCGCCA 29118 rs1022337603 0 2 288135 NT_005334.17 278135
ss2136426100 2_318917_GGGCACGTGTGCA/G -/GGCACGTGTGCA 29118 rs904035649 0 2 318918 NT_005334.17 308918
ss2136426101 2_318947_G/GTGTGCAGGCGTA -/TGTGCAGGCGTA 29118 rs999672902 0 2 318947 NT_005334.17 308947
ss2136426102 2_318956_CGTGTGTGCATGG/C -/GTGTGTGCATGG 29118 rs1031164390 0 2 318957 NT_005334.17 308957
ss2136426103 2_319262_TGTGTGCGGAAAC/T -/GTGTGCGGAAAC 29118 rs960973683 0 2 319263 NT_005334.17 309263
ss2136426104 2_319329_GTGTGTGTGTGGGCGTGTGTGCGGA/G -/TGTGTGTGTGGGCGTGTGTGCGGA 29118 rs992410557 0 2 319330 NT_005334.17 309330
ss2136426105 2_319330_TGTGTGTGTGGGC/T -/GTGTGTGTGGGC 29118 rs1023341039 0 2 319331 NT_005334.17 309331
ss2136426106 2_319374_GGTGTGTGCGTGGGTGTGTGCAGGCGTGTGTGCAGGCAC/G -/GTGTGTGCGTGGGTGTGTGCAGGCGTGTGTGCAGGCAC 29118 rs969048987 0 2 319375 NT_005334.17 309375
ss2136426107 2_319430_GGGGTGTGTGCGC/G -/GGGTGTGTGCGC 29118 rs984950110 0 2 319431 NT_005334.17 309431
ss2136426108 2_319453_AGGCGTGTGTGCGGGCACGTGTGTGTGTG/A -/GGCGTGTGTGCGGGCACGTGTGTGTGTG 29118 rs908939146 0 2 319454 NT_005334.17 309454
ss2136426109 2_335722_ATTGCATGATTCTC/A -/TTGCATGATTCTC 29118 rs940422571 0 2 335723 NT_005334.17 325723
ss2136426110 2_338172_GGGGTCTAGGCAGACC/G -/GGGTCTAGGCAGACC 29118 rs971895696 0 2 338173 NT_005334.17 328173
ss2136426111 2_355096_GTGCATGTGTGTGTCTGTGTGCA/G -/TGCATGTGTGTGTCTGTGTGCA 29118 rs923105199 0 2 355097 NT_005334.17 345097
ss2136426112 2_355679_CAACTGTTAGGTTACCACTTTTCTTCTGGCCCAAAAGAGGCTTA/C -/AACTGTTAGGTTACCACTTTTCTTCTGGCCCAAAAGAGGCTTA 29118 rs933271976 0 2 355680 NT_005334.17 345680
ss2136426113 2_362609_GGAAGATAAAGGGACATGCA/G -/GAAGATAAAGGGACATGCA 29118 rs1050268650 0 2 362610 NT_005334.17 352610
ss2136426114 2_392682_CGCAAAGAGGAAAGGGCGCACGCAGGTCACT/C -/GCAAAGAGGAAAGGGCGCACGCAGGTCACT 29118 rs911214881 0 2 392683 NT_005334.17 382683
ss2136426115 2_426494_ACAGGCACGCAGGGGGTTCCG/A -/CAGGCACGCAGGGGGTTCCG 29118 rs942691234 0 2 426495 NT_005334.17 416495
30 of 14434003 subsnp's starting at ss2136312833. ss# starting at ss