NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:TOPMED
Submitter Batch ID:topmed_chr20
Submitter Method ID:DATA FREEZE 3A
Citation:not supplied
Population:TOPMed public browser Oct 2016
Comment:not supplied
Batch Total SubSNP(ss) Count:3659764


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2136312834 20_60034_C/G C/G 29118 rs974979454 0 20 79393 NT_011387.9 19393
ss2136444664 20_64257_TGTCACCCAGGCTGGAGTG/T -/GTCACCCAGGCTGGAGTG 29118 rs1001480914 0 20 83617 NT_011387.9 23617
ss2136444665 20_69391_CCTCACATTAATTA/C -/CTCACATTAATTA 29118 rs1016898587 0 20 88751 NT_011387.9 28751
ss2136444666 20_75006_T/TGGCACCAGGGACCAGTTTTGTG -/GGCACCAGGGACCAGTTTTGTG 29118 rs963042385 0 20 94365 NT_011387.9 34365
ss2136444667 20_81978_GTGCAGTGGCGCCA/G -/TGCAGTGGCGCCA 29118 rs972981627 0 20 101338 NT_011387.9 41338
ss2136444668 20_89542_GATACCATCTC/G -/ATACCATCTC 29118 rs1026334850 0 20 108902 NT_011387.9 48902
ss2136444669 20_103900_CTAGACAGAATAT/C -/TAGACAGAATAT 29118 rs955508789 0 20 123260 NT_011387.9 63260
ss2136444670 20_108735_G/GAGTTCATGTCCTTTGCAGA -/AGTTCATGTCCTTTGCAGA 29118 rs986997989 0 20 128094 NT_011387.9 68094
ss2136444671 20_135662_CTTGAACTTAGG/C -/TTGAACTTAGG 29118 rs910968271 0 20 155022 NT_011387.9 95022
ss2136444672 20_140711_ATGTGTGGCATGTGTTCTCTT/A -/TGTGTGGCATGTGTTCTCTT 29118 rs942467995 0 20 160071 NT_011387.9 100071
ss2136444673 20_143606_A/AACTGTATGTAT -/ACTGTATGTAT 29118 rs979592479 0 20 162965 NT_011387.9 102965
ss2136444674 20_164447_TAGAAAGATAAAAA/T -/AGAAAGATAAAAA 29118 rs924935725 0 20 183807 NT_011387.9 123807
ss2136444675 20_170071_TAAGGCATAGACTC/T -/AAGGCATAGACTC 29118 rs935002905 0 20 189431 NT_011387.9 129431
ss2136444676 20_190807_TAAATAGGGG/T -/AAATAGGGG 29118 rs1052337996 0 20 210167 NT_011387.9 150167
ss2136444677 20_208916_CTTCTAATGTTT/C -/TTCTAATGTTT 29118 rs917850376 0 20 228276 NT_011387.9 168276
ss2136444678 20_214486_CCCAGGTCCTGCCACT/C -/CCAGGTCCTGCCACT 29118 rs949208105 0 20 233846 NT_011387.9 173846
ss2136444679 20_220802_T/TATTCTAAAGGATTTCCTA -/ATTCTAAAGGATTTCCTA 29118 rs1044909210 0 20 240161 NT_011387.9 180161
ss2136444680 20_260807_CGCCTAAGGTTACACCCA/C -/GCCTAAGGTTACACCCA 29118 rs905037867 0 20 280167 NT_011387.9 220167
ss2136444681 20_274750_TTGCCCAGACTGGAG/T -/TGCCCAGACTGGAG 29118 rs1001541053 0 20 294110 NT_011387.9 234110
ss2136444682 20_284397_GCTGTGGCTTTCAAA/G -/CTGTGGCTTTCAAA 29118 rs1038874799 0 20 303754 NT_011387.9 243754
ss2136444683 20_287119_G/GCACAATCT -/CACAATCT 29118 rs898472828 0 20 306475 NT_011387.9 246475
ss2136444684 20_290641_C/CACCCTCTTTCAGTGCCCCGGCG -/ACCCTCTTTCAGTGCCCCGGCG 29118 rs994601446 0 20 309997 NT_011387.9 249997
ss2136444685 20_292343_TTCTTTTTCTACTCCA/T -/TCTTTTTCTACTCCA 29118 rs1025884181 0 20 311700 NT_011387.9 251700
ss2136444686 20_294071_CACCCATCTAAT/C -/ACCCATCTAAT 29118 rs955644748 0 20 313428 NT_011387.9 253428
ss2136444687 20_300771_A/ATGCCTGTAGTCCCAGCC -/TGCCTGTAGTCCCAGCC 29118 rs1008398642 0 20 320127 NT_011387.9 260127
ss2136444688 20_302653_TGGGATTTCAGA/T -/GGGATTTCAGA 29118 rs1018413620 0 20 322010 NT_011387.9 262010
ss2136444689 20_306216_GGGCGGGGAGCGGCGCGCGCGGGCCGC/G -/GGCGGGGAGCGGCGCGCGCGGGCCGC 29118 rs964213708 0 20 325573 NT_011387.9 265573
ss2136444690 20_306233_CGCGGGCCGCG/C -/GCGGGCCGCG 29118 rs979173619 0 20 325590 NT_011387.9 265590
ss2136444691 20_308008_GCGCTAGGGCCCGCCCCTC/G -/CGCTAGGGCCCGCCCCTC 29118 rs925040509 0 20 327365 NT_011387.9 267365
ss2136444692 20_312706_ATCTCTAGTAAAGTTTT/A -/TCTCTAGTAAAGTTTT 29118 rs956380729 0 20 332063 NT_011387.9 272063
30 of 3659764 subsnp's starting at ss2136312834. ss# starting at ss