NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:TOPMED
Submitter Batch ID:topmed_chr22
Submitter Method ID:DATA FREEZE 3A
Citation:not supplied
Population:TOPMed public browser Oct 2016
Comment:not supplied
Batch Total SubSNP(ss) Count:2252231


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2136454214 22_16585951_TGCTGGGTTCTGAGTGTTTCTCCCTC/T -/GCTGGGTTCTGAGTGTTTCTCCCTC 29118 rs1032755313 0 22 15391987 NT_187355.1 237669
ss2136454213 22_16580004_A/AGCATTATAGAACAGT -/GCATTATAGAACAGT 29118 rs995933124 0 22 15397958 NT_187355.1 243640
ss2136454212 22_16516109_GGATCCTATCTGAGGGACAACTACTCAGAATCCAGCCACT/G -/GATCCTATCTGAGGGACAACTACTCAGAATCCAGCCACT 29118 rs900631940 0 22 15461815 NT_187355.1 307497
ss2136454211 22_16504112_ACAAACATTATGTATGCAC/A -/CAAACATTATGTATGCAC 29118 rs1040565123 0 22 15473833 NT_187355.1 319515
ss2136454210 22_16480630_TCTCTTGTGGGCACTTAGTGATATAAATTTCCCTC/T -/CTCTTGTGGGCACTTAGTGATATAAATTTCCCTC 29118 rs944924523 0 22 15497299 NT_187355.1 342981
ss2136454209 22_16468469_CAGAGTTAGAGGTTGGGAGTCAACGTTT/C -/AGAGTTAGAGGTTGGGAGTCAACGTTT 29118 rs886678126 0 22 15509467 NT_187355.1 355149
ss2136454208 22_16463984_GCAGGTGAATATCAGGCCT/G -/CAGGTGAATATCAGGCCT 29118 rs1048471203 0 22 15513961 NT_187355.1 359643
ss2136454207 22_16400468_TGTGTGTGTGTGTATATGTA/T -/GTGTGTGTGTGTATATGTA 29118 rs930641518 0 22 15577476 NT_187355.1 423158
ss2136454206 22_16289402_ACAGGATCGCAGC/A -/CAGGATCGCAGC 29118 rs920605116 0 22 15688549 NT_187355.1 534231
ss2136454205 22_16240392_TTCTTCAACCC/T -/TCTTCAACCC 29118 rs990826634 0 22 15737561 NT_187355.1 583243
ss2136454204 22_16229855_AGTGTGGCAGTGT/A -/GTGTGGCAGTGT 29118 rs938118657 0 22 15748096 NT_187355.1 593778
ss2136454203 22_16073262_TGCTTGGAGAA/T -/GCTTGGAGAA 29118 rs1220499122 0 22 15904691 NT_187355.1 750373
ss2136312836 22_16050164_G/T G/T 29118 N.D. N.D.
ss2136454215 22_16662637_CATAATTAGGAAAT/C -/ATAATTAGGAAAT 29118 N.D. N.D.
ss2136454216 22_16849449_AATGGAATCGAATGGAACCATCGG/A -/ATGGAATCGAATGGAACCATCGG 29118 N.D. N.D.
ss2136454217 22_16849466_CCATCGGATGGAATCGAATGGAAT/C -/CATCGGATGGAATCGAATGGAAT 29118 N.D. N.D.
ss2136454218 22_16850505_A/AAATGGAATCT -/AATGGAATCT 29118 N.D. N.D.
ss2136454219 22_16851819_C/CTCAAATGGAATTATCA -/TCAAATGGAATTATCA 29118 N.D. N.D.
ss2136454220 22_16853742_TGAATGGAAACAAC/T -/GAATGGAAACAAC 29118 N.D. N.D.
ss2136454221 22_16854877_AATCGAATGGAAAC/A -/ATCGAATGGAAAC 29118 N.D. N.D.
ss2136454222 22_16855868_AATCGAACGGAATCAGC/A -/ATCGAACGGAATCAGC 29118 N.D. N.D.
ss2136454223 22_16856669_C/CATTGAATGGA -/ATTGAATGGA 29118 N.D. N.D.
ss2136454224 22_16856767_TGAATGGAATTGAATGAAATCATCATC/T -/GAATGGAATTGAATGAAATCATCATC 29118 N.D. N.D.
ss2136454225 22_16857032_TATAATCATTGAATGGAATCAAATGGA/T -/ATAATCATTGAATGGAATCAAATGGA 29118 N.D. N.D.
ss2136454226 22_16859062_A/AATCAAATGGAATC -/ATCAAATGGAATC 29118 N.D. N.D.
ss2136454227 22_16859183_AATCAAATGGAATC/A -/ATCAAATGGAATC 29118 N.D. N.D.
ss2136454228 22_16859287_CTGGAATCATCATCGAATGGAATCGAA/C -/TGGAATCATCATCGAATGGAATCGAA 29118 N.D. N.D.
ss2136454229 22_16859733_CATGGAATCGA/C -/ATGGAATCGA 29118 N.D. N.D.
ss2136454230 22_16859813_TATCGAATGGAATAA/T -/ATCGAATGGAATAA 29118 N.D. N.D.
ss2136454231 22_16859867_AAATGGAATCATGG/A -/AATGGAATCATGG 29118 N.D. N.D.
30 of 2252231 subsnp's starting at ss2136454214. ss# starting at ss