NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:SYSTEMSBIOZJU
Submitter Batch ID:Whole_Genome_Sequencing
Submitter Method ID:RESEQ
Citation:Whole genome sequencing of matched tumor, adjacent non-tumor tissue and corresponding normal blood samples of hepatocellular carcinoma patients revealed a TP53 (R249S) mutation associated with poor prognosis
Population:hepatocellular carcinoma patients
Comment:Whole genome sequencing of matched tumor, adjacent non-tumor tissue and corresponding normal blood samples of three hepatocellular carcinoma patients from China
Batch Total SubSNP(ss) Count:5542353


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137334781 SYSTEMSBIOZJU_SNV4 A/G 2 rs1337282968 0 1 23975 NT_077402.3 13975
ss2137334782 SYSTEMSBIOZJU_SNV3660 -/AGGGAGGGAGGGAGAGGA 2 rs1194861613 0 1 1929379 NT_032977.10 1343391
ss2137334783 SYSTEMSBIOZJU_SNV4101 -/TGTCTGGGGCGCTAC 2 rs1334340633 0 1 2031630 NT_032977.10 1445642
ss2137334784 SYSTEMSBIOZJU_SNV6945 -/GGCACGCACCACCGCACCCGCATGCACCACCGCACCTG 2 rs33910396 0 1 3042652 NT_032977.10 2456664
ss2137334785 SYSTEMSBIOZJU_SNV7412 -/TCCTGAGGGGT 2 rs1230871465 0 1 3180721 NT_032977.10 2594733
ss2137334786 SYSTEMSBIOZJU_SNV7673 -/GACACCCGAAGCCAACCCCGTGGCCGCACT 2 rs1251889263 0 1 3255852 NT_032977.10 2669864
ss2137334787 SYSTEMSBIOZJU_SNV8040 -/GGACAGACAGGA 2 rs1450603569 0 1 3421933 NT_032977.10 2835945
ss2137334788 SYSTEMSBIOZJU_SNV10656 -/CTGCTTATTCTTC 2 rs1241889787 0 1 4273131 NT_032977.10 3687143
ss2137334789 SYSTEMSBIOZJU_SNV11786 -/GGGCACCTGG 2 rs1259315527 0 1 4616438 NT_032977.10 4030450
ss2137334790 SYSTEMSBIOZJU_SNV13144 -/GAAGAGGGGGAT 2 rs1485712097 0 1 5112497 NT_032977.10 4526509
ss2137334791 SYSTEMSBIOZJU_SNV16065 -/AAGGGATGTAGGGATGATGAAGGGATGATG 2 rs1164200543 0 1 6107605 NT_032977.10 5521617
ss2137334792 SYSTEMSBIOZJU_SNV16066 -/GGATGATGGAGAGATGGAGGAATAATAGAGGGATGAT 2 rs1396915301 0 1 6107696 NT_032977.10 5521708
ss2137334793 SYSTEMSBIOZJU_SNV21366 -/TCACTTGAGCCCAGGG 2 rs59005659 0 1 8342827 NT_032977.10 7756839
ss2137334794 SYSTEMSBIOZJU_SNV22136 -/TCTTTCTTTCCTTCCTTTCTTTCTTTCTTTCTTTCTT 2 rs1187289437 0 1 8843985 NT_032977.10 8257997
ss2137334795 SYSTEMSBIOZJU_SNV23087 -/TCCTCCCTCCCTTCCTCCTTTCCTTCCTTCCATCCC 2 rs1389527734 0 1 9142897 NT_032977.10 8556909
ss2137334796 SYSTEMSBIOZJU_SNV26838 -/ACCACGAGCAGGCATGTCCT 2 rs1382708032 0 1 10744731 NT_032977.10 10158743
ss2137334797 SYSTEMSBIOZJU_SNV29694 -/CTGGCGTCACAGAGGGGAACCTGGGAACAACC 2 rs1297709185 0 1 11829761 NT_032977.10 11243773
ss2137334798 SYSTEMSBIOZJU_SNV30970 -/TGTGTGTCTGTGTCTCTGTGTGAG 2 rs1362008027 0 1 12585329 NT_032977.10 11999341
ss2137334799 SYSTEMSBIOZJU_SNV39234 -/AGTGAGCACGCA 2 rs1452700552 0 1 15969006 NT_032977.10 15383018
ss2137334800 SYSTEMSBIOZJU_SNV45134 -/TAGCGCCCCTTGC 2 rs1293703493 0 1 18079094 NT_032977.10 17493106
ss2137334801 SYSTEMSBIOZJU_SNV45765 -/CTTCGGGTCTCTG 2 rs1336462809 0 1 18353277 NT_032977.10 17767289
ss2137334802 SYSTEMSBIOZJU_SNV49890 -/TCATCACCATTATCATCATTAT 2 rs1211483141 0 1 19933055 NT_032977.10 19347067
ss2137334803 SYSTEMSBIOZJU_SNV50169 -/ATGTTCCTCCGCTGAT 2 rs1311739086 0 1 20029380 NT_032977.10 19443392
ss2137334804 SYSTEMSBIOZJU_SNV51028 -/TGGTGATGTTGATGA 2 rs1350630535 0 1 20382510 NT_032977.10 19796522
ss2137334805 SYSTEMSBIOZJU_SNV51174 -/CATTATCACCACCATCATCACCACCATCACCAC 2 rs1206388516 0 1 20463596 NT_032977.10 19877608
ss2137334806 SYSTEMSBIOZJU_SNV55991 -/AAAGAAAGAAAGGAAGAAGGGAAGAAAGAAAAA 2 rs1260174558 0 1 22279932 NT_032977.10 21693944
ss2137334807 SYSTEMSBIOZJU_SNV60249 -/ATGGTTGGTTGGATGA 2 rs1428470602 0 1 24085121 NT_032977.10 23499133
ss2137334808 SYSTEMSBIOZJU_SNV62898 -/AGGATGGAAGGGCGGGAGGGAGGGAGAGAGGG 2 rs1234363887 0 1 25108872 NT_032977.10 24522884
ss2137334809 SYSTEMSBIOZJU_SNV65833 -/GTCTCGCTGT 2 rs1282977323 0 1 26481043 NT_032977.10 25895055
ss2137334810 SYSTEMSBIOZJU_SNV67130 -/ATCTGTTGC 2 rs1474333680 0 1 27477912 NT_032977.10 26891924
30 of 5542353 subsnp's starting at ss2137334781. ss# starting at ss