NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:GNOMAD
Submitter Batch ID:gnomAD_exomes_2017
Submitter Method ID:GNOMAD
Citation:not supplied
Comment:not supplied
Batch Total SubSNP(ss) Count:14653782


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137517379 exomes_rs62635282 C/G 246272 rs62635282 0 1 12198 NT_077402.3 2198
ss2730985267 exomes_gnomad_1_12237 A/G 246272 rs1324090652 0 1 12237 NT_077402.3 2237
ss2730985268 exomes_gnomad_1_12259 C/G 246272 rs1330604035 0 1 12259 NT_077402.3 2259
ss2730985269 exomes_gnomad_1_12266 A/G 246272 rs1442951560 0 1 12266 NT_077402.3 2266
ss2730985270 exomes_gnomad_1_12272 A/G 246272 rs1281272113 0 1 12272 NT_077402.3 2272
ss2730985271 exomes_gnomad_1_12554 A/G 246272 rs1371050997 0 1 12554 NT_077402.3 2554
ss2730985272 exomes_gnomad_1_12559 A/G 246272 rs1223049744 0 1 12559 NT_077402.3 2559
ss2730985273 exomes_gnomad_1_12573 C/T 246272 rs1273605438 0 1 12573 NT_077402.3 2573
ss2730985274 exomes_gnomad_1_12586 C/T 246272 rs1336625132 0 1 12586 NT_077402.3 2586
ss2730985275 exomes_gnomad_1_12596 A/C 246272 rs1211439372 0 1 12596 NT_077402.3 2596
ss2730985276 exomes_gnomad_1_12597 C/T 246272 rs1272077481 0 1 12597 NT_077402.3 2597
ss2730985277 exomes_gnomad_1_12599 -/T 246272 rs1437963543 0 1 12600 NT_077402.3 2600
ss2730985278 exomes_gnomad_1_12612 -/GT 246272 rs1205998786 0 1 12613 NT_077402.3 2613
ss2730985279 exomes_gnomad_1_12625 A/G 246272 rs1235144565 0 1 12625 NT_077402.3 2625
ss2730985280 exomes_gnomad_1_12659 C/G 246272 rs1469036210 0 1 12659 NT_077402.3 2659
ss2730985281 exomes_gnomad_1_12670 C/G 246272 rs1182032602 0 1 12670 NT_077402.3 2670
ss2730985282 exomes_gnomad_1_12672 C/T 246272 rs1419072050 0 1 12672 NT_077402.3 2672
ss2730985283 exomes_gnomad_1_12673 A/G 246272 rs1476353024 0 1 12673 NT_077402.3 2673
ss2730985284 exomes_gnomad_1_12680 A/G 246272 rs1163072234 0 1 12680 NT_077402.3 2680
ss2730985285 exomes_gnomad_1_12698 A/G 246272 rs1390273904 0 1 12698 NT_077402.3 2698
ss2730985286 exomes_gnomad_1_12719 C/G 246272 rs1410641955 0 1 12719 NT_077402.3 2719
ss2730985287 exomes_gnomad_1_12729 G/T 246272 rs1330948666 0 1 12729 NT_077402.3 2729
ss2730985288 exomes_gnomad_1_12738 -/AGTG 246272 rs1352786691 0 1 12739 NT_077402.3 2739
ss2730985289 exomes_gnomad_1_12745 -/GGGAGTGGCGTCGCCCCTAGGGCTCTAC 246272 rs1409167972 0 1 12746 NT_077402.3 2746
ss2730985290 exomes_gnomad_1_12748 C/G 246272 rs1293756602 0 1 12748 NT_077402.3 2748
ss2730985291 exomes_gnomad_1_12752 C/G 246272 rs1357144491 0 1 12752 NT_077402.3 2752
ss2730985292 exomes_gnomad_1_12754 C/G 246272 rs1231210093 0 1 12754 NT_077402.3 2754
ss2730985293 exomes_gnomad_1_12755 A/G 246272 rs1283302469 0 1 12755 NT_077402.3 2755
ss2730985294 exomes_gnomad_1_12758 -/C 246272 rs1339625912 0 1 12758 NT_077402.3 2758
ss2730985295 exomes_gnomad_1_12762 -/T 246272 rs1215868506 0 1 12763 NT_077402.3 2763
30 of 14653782 subsnp's starting at ss2137517379. ss# starting at ss