NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:GNOMAD
Submitter Batch ID:genome_batch_chr1
Submitter Method ID:GNOMAD
Citation:not supplied
Comment:not supplied
Batch Total SubSNP(ss) Count:18212554


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137517383 gnomad_1_10067 -/AACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC 30992 rs1489251879 0 1 10067 NT_077402.3 67
ss2750600803 rs62651026 -/AACCCT 30992 rs1377973775 0 1 10109 NT_077402.3 109
ss2750600804 rs376007522 -/ACCCT 30992 rs1462685959 0 1 10110 NT_077402.3 110
ss2750600805 gnomad_1_10119 -/T 30992 rs1156821933 0 1 10120 NT_077402.3 120
ss2750600806 gnomad_1_10120 C/T 30992 rs1390810297 0 1 10120 NT_077402.3 120
ss2750600807 rs796688738 -/CCCTAACCCTAACCCTAAC 30992 rs1457723673 0 1 10129 NT_077402.3 129
ss2750600808 gnomad_1_10131 -/T 30992 rs1289482855 0 1 10132 NT_077402.3 132
ss2750600809 gnomad_1_10132 -/AACCC 30992 rs1390118706 0 1 10133 NT_077402.3 133
ss2750600810 gnomad_1_10134 -/CCCTAACCCTAAC 30992 rs1385251551 0 1 10135 NT_077402.3 135
ss2750600811 gnomad_1_10135 -/CCTAA 30992 rs1303755152 0 1 10136 NT_077402.3 136
ss2750600812 gnomad_1_10137 C/G 30992 rs1346539515 0 1 10137 NT_077402.3 137
ss2750600813 gnomad_1_10138 C/T 30992 rs1228214171 0 1 10138 NT_077402.3 138
ss2750600814 gnomad_1_10149 -/CT 30992 rs1286868604 0 1 10150 NT_077402.3 150
ss2750600815 gnomad_1_10153 A/C/G 30992 rs1331781659 0 1 10153 NT_077402.3 153
ss2750600816 gnomad_1_10154 -/CCTAA 30992 rs1240389757 0 1 10155 NT_077402.3 155
ss2750600817 gnomad_1_10155 -/CTAACCCTAACCCTAACCCTAA 30992 rs1264289758 0 1 10156 NT_077402.3 156
ss2750600818 gnomad_1_10156 -/TAACCCTAACCCTAACCCTAACCT 30992 rs1487252449 0 1 10157 NT_077402.3 157
ss2750600819 gnomad_1_10159 A/C/G 30992 rs1211258708 0 1 10159 NT_077402.3 159
ss2750600820 gnomad_1_10160 A/C 30992 rs1269202771 0 1 10160 NT_077402.3 160
ss2750600822 gnomad_1_10163 C/T 30992 rs1179689498 0 1 10163 NT_077402.3 163
ss2750600821 gnomad_1_10162 -/TAACCCTAACCCTAACCT 30992 rs1482594023 0 1 10163 NT_077402.3 163
ss2750600823 gnomad_1_10164 A/T 30992 rs1413947121 0 1 10164 NT_077402.3 164
ss2750600824 gnomad_1_10166 C/G 30992 rs1419534173 0 1 10166 NT_077402.3 166
ss2750600825 gnomad_1_10167 -/CTAACCCTAA 30992 rs1164014856 0 1 10168 NT_077402.3 168
ss2750600826 gnomad_1_10168 -/TAACCCTAACCT 30992 rs1367957502 0 1 10169 NT_077402.3 169
ss2750600827 gnomad_1_10169 C/G/T 30992 rs1456517851 0 1 10169 NT_077402.3 169
ss2750600828 gnomad_1_10171 A/C 30992 rs1295478283 0 1 10171 NT_077402.3 171
ss2750600829 gnomad_1_10172 -/CCTAA 30992 rs1366371903 0 1 10173 NT_077402.3 173
ss2750600830 gnomad_1_10173 -/CTAA 30992 rs1409475383 0 1 10174 NT_077402.3 174
ss2750600831 gnomad_1_10174 -/TAACCT 30992 rs1306484214 0 1 10175 NT_077402.3 175
30 of 18212554 subsnp's starting at ss2137517383. ss# starting at ss