NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:GNOMAD
Submitter Batch ID:genome_batch_chr2
Submitter Method ID:GNOMAD
Citation:not supplied
Comment:not supplied
Batch Total SubSNP(ss) Count:19652333


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2768813359 gnomad_2_10230 -/C 30992 rs1376142270 0 2 10230 NT_005334.17 230
ss2768813366 gnomad_2_10261 -/ACCCTG 30992 rs1233117487 0 2 10261 NT_005334.17 261
ss2768813368 gnomad_2_10272 -/G 30992 rs1349387566 0 2 10272 NT_005334.17 272
ss2768813369 rs533610139 -/CCTAACCCTTTACCCTAACCCGAACCCCTAACCCCTAACCCCTAACCCT 30992 rs1213078649 0 2 10276 NT_005334.17 276
ss2768813370 gnomad_2_10280 -/CCCTTTACCCTAACCCGAACCCCTAAC 30992 rs1260028157 0 2 10281 NT_005334.17 281
ss2768813373 gnomad_2_10285 -/CACCC 30992 rs1250910192 0 2 10285 NT_005334.17 285
ss2768813374 gnomad_2_10295 -/CTAACA 30992 rs1453641178 0 2 10295 NT_005334.17 295
ss2768813375 gnomad_2_10300 -/CCTTTA 30992 rs1491130920 0 2 10300 NT_005334.17 300
ss2768813376 gnomad_2_10302 C/G 30992 rs1395974756 0 2 10302 NT_005334.17 302
ss2768813378 gnomad_2_10304 A/G/T 30992 rs953919324 0 2 10304 NT_005334.17 304
ss2768813379 gnomad_2_10306 -/C 30992 rs1363682653 0 2 10307 NT_005334.17 307
ss2768813380 gnomad_2_10309 C/G 30992 rs1454778673 0 2 10309 NT_005334.17 309
ss2768813382 gnomad_2_10313 -/C 30992 rs1392718444 0 2 10314 NT_005334.17 314
ss2768813384 rs186644623 C/G/T 30992 rs186644623 0 2 10315 NT_005334.17 315
ss2768813383 gnomad_2_10314 -/CCCTAACCCTTAA 30992 rs1440687802 0 2 10315 NT_005334.17 315
ss2768813385 gnomad_2_10317 C/G 30992 rs1372757459 0 2 10317 NT_005334.17 317
ss2768813386 gnomad_2_10318 G/T 30992 rs1221526498 0 2 10318 NT_005334.17 318
ss2768813387 rs199567497 -/CCTTAA 30992 rs1305688254 0 2 10322 NT_005334.17 322
ss2768813388 rs561194420 C/T 30992 rs561194420 0 2 10324 NT_005334.17 324
ss2768813389 gnomad_2_10332 A/G 30992 rs1241091434 0 2 10332 NT_005334.17 332
ss2768813390 gnomad_2_10333 A/T 30992 rs1271260927 0 2 10333 NT_005334.17 333
ss2768813391 gnomad_2_10334 C/G/T 30992 rs1467852231 0 2 10334 NT_005334.17 334
ss2768813392 gnomad_2_10336 -/T 30992 rs1214141743 0 2 10337 NT_005334.17 337
ss2768813393 gnomad_2_10343 -/T 30992 rs1253822347 0 2 10343 NT_005334.17 343
ss2768813394 rs193294418 A/C/G/T 30992 rs193294418 0 2 10345 NT_005334.17 345
ss2768813395 gnomad_2_10349 C/G 30992 rs1175501095 0 2 10349 NT_005334.17 349
ss2768813396 gnomad_2_10350 A/T 30992 rs1249920197 0 2 10350 NT_005334.17 350
ss2768813398 gnomad_2_10357 A/C/G 30992 rs1409726949 0 2 10357 NT_005334.17 357
ss2768813399 gnomad_2_10358 -/CCGTG 30992 rs1416384779 0 2 10359 NT_005334.17 359
ss2768813400 gnomad_2_10359 C/T 30992 rs1461212176 0 2 10359 NT_005334.17 359
30 of 17994905 subsnp's starting at ss2768813359. ss# starting at ss