NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:GNOMAD
Submitter Batch ID:genome_batch_chr4
Submitter Method ID:GNOMAD
Citation:not supplied
Comment:not supplied
Batch Total SubSNP(ss) Count:15662678


<
SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137517386 rs868983343 A/T 30992 N.D. N.D.
ss2804516951 gnomad_4_10104 -/C 30992 N.D. N.D.
ss2804516952 gnomad_4_10105 -/CCTAACCCTA 30992 N.D. N.D.
ss2804516953 rs868946050 A/T 30992 N.D. N.D.
ss2804516954 gnomad_4_10122 -/CCTAA 30992 N.D. N.D.
ss2804516955 gnomad_4_10124 -/T 30992 N.D. N.D.
ss2804516956 gnomad_4_10129 -/CTAACCCTAACCCTAACCCTAACCCTAACCCTAACG 30992 N.D. N.D.
ss2804516957 gnomad_4_10130 -/T 30992 N.D. N.D.
ss2804516958 gnomad_4_10134 -/CCTAACCCTAACCCTAACCCTAACCCTAACGCTAACCCTAACCCTAA 30992 N.D. N.D.
ss2804516959 gnomad_4_10135 -/CTAACCCTAACCCTAACCCTAACCCTAACG 30992 N.D. N.D.
ss2804516960 gnomad_4_10140 -/CCTAA 30992 N.D. N.D.
ss2804516961 gnomad_4_10141 -/CTAACCCTAACCCTAACCCTAACG 30992 N.D. N.D.
ss2804516962 gnomad_4_10144 A/T 30992 N.D. N.D.
ss2804516963 gnomad_4_10145 A/C 30992 N.D. N.D.
ss2804516964 gnomad_4_10147 -/CTAACCCTAACCCTAACG 30992 N.D. N.D.
ss2804516965 gnomad_4_10150 -/ACCCCT 30992 N.D. N.D.
ss2804516966 gnomad_4_10151