NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:SWEGEN
Submitter Batch ID:SWEGEN
Submitter Method ID:ILLUMINA_WGS
Citation:not supplied
Population:SWEGEN
Comment:not supplied
Batch Total SubSNP(ss) Count:34858637


all, sort by
SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137518744 NC_000001.10:10147_10147del -/C 2000 rs779258992 0 1 10147 NT_077402.3 147
ss2986141200 NC_000001.10:10169_10180del -/TAACCCTAACCT 2000 rs1367957502 0 1 10169 NT_077402.3 169
ss2986141201 NC_000001.10:g.10181A>T A/T 2000 rs1246412344 0 1 10181 NT_077402.3 181
ss2986141202 NC_000001.10:g.10247T>C C/T 2000 rs796996180 0 1 10247 NT_077402.3 247
ss2986141203 NC_000001.10:g.10250A>C A/C 2000 rs199706086 0 1 10250 NT_077402.3 250
ss2986141204 NC_000001.10:g.10291C>T C/T 2000 rs145427775 0 1 10291 NT_077402.3 291
ss2986141205 NC_000001.10:g.10327T>C C/T 2000 rs112750067 0 1 10327 NT_077402.3 327
ss2986141206 NC_000001.10:10330_10330del -/C 2000 rs150969722 0 1 10330 NT_077402.3 330
ss2986141207 NC_000001.10:10334_10334del -/T 2000 rs1351390918 0 1 10334 NT_077402.3 334
ss2986141208 NC_000001.10:g.10340T>C C/T 2000 rs1471210572 0 1 10340 NT_077402.3 340
ss2986141209 NC_000001.10:g.10473G>A A/G 2000 rs1408062762 0 1 10473 NT_077402.3 473
ss2986141210 NC_000001.10:g.10478C>G C/G 2000 rs528916756 0 1 10478 NT_077402.3 478
ss2986141211 NC_000001.10:g.10480_10481insA -/A 2000 rs1229407220 0 1 10480 NT_077402.3 480
ss2986141212 NC_000001.10:g.10492C>T C/T 2000 rs55998931 0 1 10492 NT_077402.3 492
ss2986141213 NC_000001.10:g.10493C>G C/G 2000 rs199606420 0 1 10493 NT_077402.3 493
ss2986141214 NC_000001.10:g.10539C>A A/C 2000 rs537182016 0 1 10539 NT_077402.3 539
ss2986141215 NC_000001.10:g.10583G>A A/G 2000 rs58108140 0 1 10583 NT_077402.3 583
ss2986141216 NC_000001.10:g.10588C>T C/T 2000 rs1401244958 0 1 10588 NT_077402.3 588
ss2986141217 NC_000001.10:g.10593T>C C/T 2000 rs1338690120 0 1 10593 NT_077402.3 593
ss2986141218 NC_000001.10:g.10611C>G C/G 2000 rs189107123 0 1 10611 NT_077402.3 611
ss2986141219 NC_000001.10:10617_10637del -/CGCCGTTGCAAAGGCGCGCCG 2000 rs376342519 0 1 10617 NT_077402.3 617
ss2986141220 NC_000001.10:g.10815_10816insC -/C 2000 rs1205319490 0 1 10815 NT_077402.3 815
ss2986141221 NC_000001.10:g.10816_10817insCA -/CA 2000 rs1266288166 0 1 10816 NT_077402.3 816
ss2986141222 NC_000001.10:g.10904G>A A/G 2000 rs10218493 0 1 10904 NT_077402.3 904
ss2986141223 NC_000001.10:g.10927A>G A/G 2000 rs10218527 0 1 10927 NT_077402.3 927
ss2986141224 NC_000001.10:g.10938G>A A/G 2000 rs28853987 0 1 10938 NT_077402.3 938
ss2986141225 NC_000001.10:g.10990C>G C/G 2000 rs1264382357 0 1 10990 NT_077402.3 990
ss2986141226 NC_000001.10:g.12659G>C C/G 2000 rs1469036210 0 1 12659 NT_077402.3 2659