NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:MCHAISSO
Submitter Batch ID:HG00514
Submitter Method ID:UNIFIEDCALLSET
Citation:Multi-platform discovery of haplotype-resolved structural variation in human genomes
Population:CHS-PUR-YRI
Comment:not supplied
Batch Total SubSNP(ss) Count:812541
Method Extra Detail:THIS IS UNIFIED CALLSET BETWEEN READ-BASED ILLUMINA CALLS AND ASSEMBLY BASED PACBIO CALLS


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137543779 HG005141 -/C 46 rs557514207 0 1 15903 NT_077402.3 5903
ss3063573406 HG005142 -/TT 46 rs1491237799 0 1 28589 NT_077402.3 18589
ss3063573407 HG005143 -/TGG 46 rs757557694 0 1 28590 NT_077402.3 18590
ss3063573408 HG005144 -/TTTC 46 rs773293602 0 1 54713 NT_077402.3 44713
ss3063573409 HG005145 -/CTA 46 rs201888535 0 1 63736 NT_077402.3 53736
ss3063573410 HG005146 -/G 46 rs574185548 0 1 64513 NT_077402.3 54513
ss3063573411 HG005147 -/TATATA 46 rs201684885 0 1 66161 NT_077402.3 56161
ss3063573412 HG005148 -/AA 46 rs550749506 0 1 82134 NT_077402.3 72134
ss3063573413 HG005149 -/AGAAAGAA 46 rs1394597135 0 1 83829 NT_077402.3 73829
ss3063573414 HG0051410 -/AAAGAAAGAAAGAAAGAAAA 46 rs1336586596 0 1 83994 NT_077402.3 73994
ss3063573415 HG0051411 -/AAAA 46 rs1341255223 0 1 84002 NT_077402.3 74002
ss3063573416 HG0051412 -/AAAGA 46 rs372284318 0 1 84030 NT_077402.3 74030
ss3063573417 HG0051413 -/C 46 rs200856736 0 1 94422 NT_077402.3 84422
ss3063573418 HG0051414 -/TTTT 46 rs1355933852 0 1 98999 NT_077402.3 88999
ss3063573419 HG0051415 -/ACACAC 46 rs372078516 0 1 104160 NT_077402.3 94160
ss3063573420 HG0051416 -/ACAC 46 rs372078516 0 1 104160 NT_077402.3 94160
ss3063573421 HG0051417 -/A 46 rs368700889 0 1 108545 NT_077402.3 98545
ss3063573422 HG0051418 -/T 46 rs201432136 0 1 109107 NT_077402.3 99107
ss3063573423 HG0051419 -/GT 46 rs1279101429 0 1 109576 NT_077402.3 99576
ss3063573424 HG0051420 -/AT 46 rs796462195 0 1 120995 NT_077402.3 110995
ss3063573425 HG0051421 -/ATTATA 46 rs1176369077 0 1 121041 NT_077402.3 111041
ss3063573426 HG0051422 -/A 46 rs780819404 0 1 124497 NT_077402.3 114497
ss3063573427 HG0051423 -/ATG 46 rs377161483 0 1 129011 NT_077402.3 119011
ss3063573428 HG0051424 -/AGA 46 rs1354754438 0 1 133707 NT_077402.3 123707
ss3063573429 HG0051425 -/GCGTGGGAGGGGCCGGTGTGAGGCAAGGGGCTCGGGCTGACCTCTGTCC 46 rs1377516609 0 1 136863 NT_077402.3 126863
ss3063573430 HG0051426 -/GGGCTCGGGCTGACCTCTCTCAGCGTGGGAGGGGCCGGTGTGAGGCAA 46 rs1465014109 0 1 136889 NT_077402.3 126889
ss3063573431 HG0051427 -/TATATATATATATATATATATATATATATATA 46 rs1174871207 0 1 144528 NT_077402.3 134528
ss3063573432 HG0051428 -/TATATATATATATATATATATATATATG 46 rs1403329792 0 1 144550 NT_077402.3 134550
ss3063573433 HG0051429 -/GG 46 rs1195257599 0 1 157922 NT_077402.3 147922
ss3063573434 HG0051430 -/GGGCCA 46 rs1329558241 0 1 185761 NT_077402.3 175761
30 of 812541 subsnp's starting at ss2137543779. ss# starting at ss

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement