NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:TOPMED
Submitter Batch ID:Freeze 5 variant calls-chr10
Submitter Method ID:FREEZE 5
Citation:not supplied
Population:freeze 5 samples
Comment:not supplied
Batch Total SubSNP(ss) Count:25530599


all, sort by
SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137543787 TOPMed_freeze_5?chr10:10,023 A/C 125568 rs1243990134 0 10 10023 NT_008705.17 23
ss3109317708 TOPMed_freeze_5?chr10:10,184 A/G 125568 rs1270958299 0 10 10184 NT_008705.17 184
ss3109317709 TOPMed_freeze_5?chr10:10,190 A/G 125568 rs1216899910 0 10 10190 NT_008705.17 190
ss3109317710 TOPMed_freeze_5?chr10:10,196 A/G 125568 rs1340697370 0 10 10196 NT_008705.17 196
ss3109317711 TOPMed_freeze_5?chr10:10,202 A/G 125568 rs1303249727 0 10 10202 NT_008705.17 202
ss3109317712 TOPMed_freeze_5?chr10:10,208 A/G 125568 rs1439203031 0 10 10208 NT_008705.17 208
ss3109317713 TOPMed_freeze_5?chr10:10,214 A/G 125568 rs1373606372 0 10 10214 NT_008705.17 214
ss3109317714 TOPMed_freeze_5?chr10:10,236 C/T 125568 rs1326225571 0 10 10236 NT_008705.17 236
ss3109317715 TOPMed_freeze_5?chr10:10,277 -/T 125568 rs1441003511 0 10 10277 NT_008705.17 277
ss3109317716 TOPMed_freeze_5?chr10:10,301 -/T 125568 rs1352327847 0 10 10301 NT_008705.17 301
ss3109317717 TOPMed_freeze_5?chr10:10,325 -/T 125568 rs1330310948 0 10 10325 NT_008705.17 325
ss3109317718 TOPMed_freeze_5?chr10:10,349 -/T 125568 rs1409986097 0 10 10349 NT_008705.17 349
ss3109317720 TOPMed_freeze_5?chr10:10,374-01 C/T 125568 rs1171642273 0 10 10374 NT_008705.17 374
ss3109317719 TOPMed_freeze_5?chr10:10,373 -/T 125568 rs1394429754 0 10 10374 NT_008705.17 374
ss3109317721 TOPMed_freeze_5?chr10:10,374-02 -/TAACCC 125568 rs1455455531 0 10 10375 NT_008705.17 375
ss3109317723 TOPMed_freeze_5?chr10:10,380-02 C/T 125568 rs1194566343 0 10 10380 NT_008705.17 380
ss3109317722 TOPMed_freeze_5?chr10:10,380-01 -/T 125568 rs1395434600 0 10 10380 NT_008705.17 380
ss3109317724 TOPMed_freeze_5?chr10:10,386 C/T 125568 rs1480428716 0 10 10386 NT_008705.17 386
ss3109317725 TOPMed_freeze_5?chr10:10,387 G/T 125568 rs1231328843 0 10 10387 NT_008705.17 387
ss3109317726 TOPMed_freeze_5?chr10:10,398 -/T 125568 rs1206741248 0 10 10398 NT_008705.17 398
ss3109317727 TOPMed_freeze_5?chr10:10,399 G/T 125568 rs1438426002 0 10 10399 NT_008705.17 399
ss3109317728 TOPMed_freeze_5?chr10:10,409 -/CTAACCCTAACCCTAACCCTCACCCTT 125568 rs1280288787 0 10 10410 NT_008705.17 410
ss3109317729 TOPMed_freeze_5?chr10:10,411 G/T 125568 rs1232710014 0 10 10411 NT_008705.17 411
ss3109317730 TOPMed_freeze_5?chr10:10,412 A/C 125568 rs1350570950 0 10 10412 NT_008705.17 412
ss3109317731 TOPMed_freeze_5?chr10:10,418 -/ACCCTAACCCTC 125568 rs1304617064 0 10 10419 NT_008705.17 419
ss3109317732 TOPMed_freeze_5?chr10:10,421 -/CTAACCCTCACCCTT 125568 rs1223505123 0 10 10422 NT_008705.17 422
ss3109317733 TOPMed_freeze_5?chr10:10,423 C/T 125568 rs1370747482 0 10 10423 NT_008705.17 423
ss3109317734 TOPMed_freeze_5?chr10:10,424-01