NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:EGCUT_WGS
Submitter Batch ID:E22
Submitter Method ID:PCR_FREE_WGS
Citation:Genetic variation in the Estonian population: pharmacogenomics study of adverse drug effects using electronic health records
Population:EGCUT_WGS
Comment:not supplied
Batch Total SubSNP(ss) Count:31728497


all, sort by
SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137543936 VAR1 A/G 2240 N.D. N.D.
ss3654261754 VAR2 C/G 2240 N.D. N.D.
ss3654261755 VAR3 A/T 2240 N.D. N.D.
ss3654261756 VAR4 C/T 2240 N.D. N.D.
ss3654261757 VAR5 A/G 2240 N.D. N.D.
ss3654261758 VAR6 A/G 2240 N.D. N.D.
ss3654261759 VAR7 A/G 2240 N.D. N.D.
ss3654261760 VAR8 A/G 2240 N.D. N.D.
ss3654261761 VAR9 C/T 2240 N.D. N.D.
ss3654261762 VAR10 A/G 2240 N.D. N.D.
ss3654261763 VAR11 A/G 2240 N.D. N.D.
ss3654261764 VAR12 -/TGCTCTGTCACCCAGGCTGGAG 2240 N.D. N.D.
ss3654261765 VAR13 A/G 2240 N.D. N.D.
ss3654261766 VAR14 C/T 2240 N.D.