NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:EVA_DECODE
Submitter Batch ID:DECODE2
Submitter Method ID:ILLUMINA HISEQ 2000, ILLUMINA GENOME ANALYZER IIX
Citation:not supplied
Comment:not supplied
Batch Total SubSNP(ss) Count:38997776


all, sort by
SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137543938 deCODE2_1 -/CCCCAA 30440 N.D. N.D.
ss3685990260 deCODE2_2 -/A 30440 N.D. N.D.
ss3685990261 deCODE2_3 -/ACCCTAAA 30440 N.D. N.D.
ss3685990262 deCODE2_4 -/AAACCCTAAACCCTAACCC 30440 N.D. N.D.
ss3685990263 deCODE2_5 -/AAACCCTAAACCC 30440 N.D. N.D.
ss3685990264 deCODE2_10 -/AAACCC 30440 N.D. N.D.
ss3685990265 deCODE2_6 -/CCCAA 30440 N.D. N.D.
ss3685990266 deCODE2_7 -/A 30440 N.D. N.D.
ss3685990267 deCODE2_8 -/AACCCTAA 30440 N.D. N.D.
ss3685990268 deCODE2_9 -/AAACCCTAACCC 30440 N.D. N.D.
ss3685990269 deCODE2_11 -/C 30440 N.D. N.D.
ss3685990270 deCODE2_12 -/ACTCCGCCGTTGCAAAGGCGC 30440 N.D. N.D.
ss3685990271 deCODE2_13 -/CTCCGCCGTTGCAAAGGCGCG 30440 N.D. N.D.
ss3685990272 deCODE2_14 -/CCGCCGTTGCAAAGGCGCGCC 30440 N.D.