NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:ACPOP
Submitter Batch ID:ACPOP
Submitter Method ID:WGS_ILLUMINA
Citation:A whole-genome sequenced control population in northern Sweden reveals subregional genetic differences.
Population:ACPOP
Comment:not supplied
Batch Total SubSNP(ss) Count:17325625


all, sort by
SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137543940 1:14 -/CCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA 600 N.D. N.D.
ss3726715137 1:24 -/C 600 N.D. N.D.
ss3726715138 1:30 C/G 600 N.D. N.D.
ss3726715139 1:31 G/T 600 N.D. N.D.
ss3726715140 1:51 C/G 600 N.D. N.D.
ss3726715141 1:62 C/G 600 N.D. N.D.
ss3726715142 1:93 A/G 600 N.D. N.D.
ss3726715143 1:115 C/G 600 N.D. N.D.
ss3726715144 1:153 A/G 600 N.D. N.D.
ss3726715145 1:155 A/G 600 N.D. N.D.
ss3726715146 1:170 -/G 600 N.D. N.D.
ss3726715147 1:199 C/T 600 N.D. N.D.
ss3726715148 1:211 C/T 600 N.D. N.D.
ss3726715149 1:233 A/G 600 N.D.