NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:KHV_HUMAN_GENOMES
Submitter Batch ID:KHV_VIN
Submitter Method ID:KHV_NGS
Citation:A Vietnamese Genetic Variation Database
Comment:not supplied
Batch Total SubSNP(ss) Count:24798874


all, sort by
SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137544025 VIN00000001 -/C 308 N.D. N.D.
ss3798742389 VIN00000002 -/A 308 N.D. N.D.
ss3798742390 VIN00000003 C/T 308 N.D. N.D.
ss3798742391 VIN00000004 A/C 308 N.D. N.D.
ss3798742392 VIN00000005 -/CGCCGTTGCAAAGGCGCGCCG 308 N.D. N.D.
ss3798742393 VIN00000006 A/G 308 N.D. N.D.
ss3798742394 VIN00000007 C/G 308 N.D. N.D.
ss3798742395 VIN00000008 C/G 308 N.D. N.D.
ss3798742396 VIN00000009 A/G 308 N.D. N.D.
ss3798742397 VIN00000010 G/T 308 N.D. N.D.
ss3798742398 VIN00000011 A/G 308 N.D. N.D.
ss3798742399 VIN00000012 C/G 308 N.D. N.D.
ss3798742400 VIN00000013 C/T 308 N.D. N.D.
ss3798742401 VIN00000014 G/T 308 N.D. N.D.
ss3798742402 VIN00000015 A/T 308 N.D. N.D.
ss3798742403 VIN00000016 A/T 308 N.D. N.D.
ss3798742404 VIN00000017 A/G 308 N.D. N.D.
ss3798742405 VIN00000018 A/G 308 N.D. N.D.
ss3798742406 VIN00000019 A/G 308 N.D. N.D.
ss3798742407 VIN00000020 G/T 308 N.D. N.D.
ss3798742408 VIN00000021 A/T 308 N.D. N.D.
ss3798742409 VIN00000022 A/G 308 N.D. N.D.
ss3798742410 VIN00000023 A/G 308 N.D. N.D.
ss3798742411 VIN00000024 A/G 308 N.D. N.D.
ss3798742412 VIN00000025 A/G 308 N.D. N.D.
ss3798742413 VIN00000026 G/T 308 N.D. N.D.
ss3798742414 VIN00000027 -/C 308 N.D. N.D.
ss3798742415 VIN00000028 A/G 308 N.D. N.D.
ss3798742416 VIN00000029 C/T 308 N.D. N.D.
ss3798742417 VIN00000030 A/C 308 N.D. N.D.
30 of 24798874 subsnp's starting at ss2137544025. ss# starting at ss