NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:EVA
Submitter Batch ID:PRJEB15384
Submitter Method ID:ILLUMINA
Citation:not supplied
Population:PRJEB15384
Comment:not supplied
Batch Total SubSNP(ss) Count:5539818


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137544058 PRJEB15384_1_727034 C/T 4 N.D. N.D.
ss3841782293 PRJEB15384_1_727242 A/G 4 N.D. N.D.
ss3841782294 PRJEB15384_1_727477 A/G 4 N.D. N.D.
ss3841782295 PRJEB15384_1_727717 C/G 4 N.D. N.D.
ss3841782296 PRJEB15384_1_729886 C/T 4 N.D. N.D.
ss3841782297 PRJEB15384_1_736852 C/T 4 N.D. N.D.
ss3841782298 PRJEB15384_1_740738 C/T 4 N.D. N.D.
ss3841782299 PRJEB15384_1_744224 A/C 4 N.D. N.D.
ss3841782300 PRJEB15384_1_758351 A/G 4 N.D. N.D.
ss3841782301 PRJEB15384_1_758443 C/G 4 N.D. N.D.
ss3841782302 PRJEB15384_1_766566 A/G 4 N.D. N.D.
ss3841782303 PRJEB15384_1_768987 C/T 4 N.D. N.D.
ss3841782304 PRJEB15384_1_770502 A/G 4 N.D. N.D.
ss3841782305 PRJEB15384_1_770988 A/G 4 N.D. N.D.
ss3841782306 PRJEB15384_1_771398 A/G 4 N.D. N.D.
ss3841782307 PRJEB15384_1_772142 C/G 4 N.D. N.D.
ss3841782308 PRJEB15384_1_772711 A/G 4 N.D. N.D.
ss3841782309 PRJEB15384_1_774742 C/T 4 N.D. N.D.
ss3841782310 PRJEB15384_1_779047 A/G 4 N.D. N.D.
ss3841782311 PRJEB15384_1_779968 G/T 4 N.D. N.D.
ss3841782312 PRJEB15384_1_780616 A/T 4 N.D. N.D.
ss3841782313 PRJEB15384_1_783006 A/G 4 N.D. N.D.
ss3841782314 PRJEB15384_1_783175 C/T 4 N.D. N.D.
ss3841782315 PRJEB15384_1_784860 C/T 4 N.D. N.D.
ss3841782316 PRJEB15384_1_785417 A/G 4 N.D. N.D.
ss3841782317 PRJEB15384_1_788418 -/AG 4 N.D. N.D.
ss3841782318 PRJEB15384_1_788511 C/G 4 N.D. N.D.
ss3841782319 PRJEB15384_1_789568 -/ATGGA 4 N.D. N.D.
ss3841782320 PRJEB15384_1_789680 -/GGAATGGAAT 4 N.D. N.D.
ss3841782321 PRJEB15384_1_789921 -/GAATGGAATGGAATGGAATG 4 N.D. N.D.
30 of 5539818 subsnp's starting at ss2137544058. ss# starting at ss