NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:GNOMAD
Submitter Batch ID:xap.reformatted
Submitter Method ID:GNOMAD
Citation:not supplied
Comment:not supplied
Batch Total SubSNP(ss) Count:15000000


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137544136 rs1375572023 -/TATGTGTG 143404 N.D. N.D.
ss4231335150 rs1172436819 -/TATGTGTGTG 143404 N.D. N.D.
ss4231335151 v3_novel_225000003 -/TATGTGTGTGTGTG 143404 N.D. N.D.
ss4231335152 rs1432854920 -/TATGTGTGTGTGTGTG 143404 N.D. N.D.
ss4231335153 v3_novel_225000005 -/TATGTGTGTGTGTGTGTG 143404 N.D. N.D.
ss4231335154 rs1410046698 -/TATGTGTGTGTGTGTGTGTG 143404 N.D. N.D.
ss4231335155 rs1159017334 -/TATGTGTGTGTGTGTGTGTGTG 143404 N.D. N.D.
ss4231335156 rs1469440732 C/T 143404 N.D. N.D.
ss4231335157 v3_novel_225000009 -/TG 143404 N.D. N.D.
ss4231335158 v3_novel_225000010 -/TGTG 143404 N.D. N.D.
ss4231335159 v3_novel_225000011 -/TGTGTG 143404 N.D. N.D.
ss4231335160 v3_novel_225000012 -/TGTGTGTG 143404 N.D. N.D.
ss4231335161 v3_novel_225000013 -/TGTGTGTGTG 143404 N.D. N.D.
ss4231335162 v3_novel_225000014 -/TGTGTGTGTGTG 143404 N.D. N.D.
ss4231335163 v3_novel_225000015 -/TGTGTGTGTGTGTG 143404 N.D. N.D.
ss4231335164 v3_novel_225000016 -/TGTGTGTGTGTGTGTG 143404 N.D. N.D.
ss4231335165 v3_novel_225000017 -/TGTGTGTGTGTGTGTGTG 143404 N.D. N.D.
ss4231335166 rs1039543248 A/G 143404 N.D. N.D.
ss4231335167 rs1224764057 -/TG 143404 N.D. N.D.
ss4231335168 rs572708148 -/TGTG 143404 N.D. N.D.
ss4231335169 rs751562585 -/TGTGTG 143404 N.D. N.D.
ss4231335170 rs763255889 -/TGTGTGTG 143404 N.D. N.D.
ss4231335171 rs1355688416 -/TGTGTGTGTG 143404 N.D. N.D.
ss4231335172 rs1311804324 -/TGTGTGTGTGTG 143404 N.D. N.D.
ss4231335173 rs1412398907 -/TGTGTGTGTGTGTG 143404 N.D. N.D.
ss4231335174 rs1346386704 -/TGTGTGTGTGTGTGTG 143404 N.D. N.D.
ss4231335175 rs1318926310 -/TGTGTGTGTGTGTGTGTG 143404 N.D. N.D.
ss4231335176 rs77939326 -/TGTGTGTGTGTGTGTGTGTG 143404 N.D. N.D.
ss4231335177 rs1405584840 -/TGTGTGTGTGTGTGTGTGTGTG 143404 N.D. N.D.
ss4231335178 rs1166790165 -/TGTGTGTGTGTGTGTGTGTGTGTG 143404 N.D. N.D.
30 of 15000000 subsnp's starting at ss2137544136. ss# starting at ss