NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:GNOMAD
Submitter Batch ID:xax.reformatted
Submitter Method ID:GNOMAD
Citation:not supplied
Comment:not supplied
Batch Total SubSNP(ss) Count:15000000


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137544145 rs1293076824 C/T 143404 N.D. N.D.
ss4366335141 rs1229502110 C/T 143404 N.D. N.D.
ss4366335142 v3_novel_345000003 A/T 143404 N.D. N.D.
ss4366335143 rs1414750933 C/T 143404 N.D. N.D.
ss4366335144 rs1462870198 C/T 143404 N.D. N.D.
ss4366335145 v3_novel_345000006 G/T 143404 N.D. N.D.
ss4366335146 rs1476199494 A/T 143404 N.D. N.D.
ss4366335147 v3_novel_345000008 A/G 143404 N.D. N.D.
ss4366335148 rs1474191711 A/G 143404 N.D. N.D.
ss4366335149 rs1177562579 C/T 143404 N.D. N.D.
ss4366335150 rs1215205175 C/T 143404 N.D. N.D.
ss4366335151 rs1271995664 C/G 143404 N.D. N.D.
ss4366335152 rs1233148944 C/T 143404 N.D. N.D.
ss4366335153 rs1309869790 G/T 143404 N.D. N.D.
ss4366335154 v3_novel_345000015 A/G 143404 N.D. N.D.
ss4366335155 rs1392300087 -/GATA 143404 N.D. N.D.
ss4366335156 rs754410887 A/T 143404 N.D. N.D.
ss4366335157 rs919711431 C/T 143404 N.D. N.D.
ss4366335158 v3_novel_345000019 G/T 143404 N.D. N.D.
ss4366335159 v3_novel_345000020 -/AAGATGATAGATGGATGAATGATAAC 143404 N.D. N.D.
ss4366335160 v3_novel_345000021 A/C 143404 N.D. N.D.
ss4366335161 v3_novel_345000022 A/T 143404 N.D. N.D.
ss4366335162 rs1195043773 -/A 143404 N.D. N.D.
ss4366335163 rs1468655447 A/C 143404 N.D. N.D.
ss4366335164 rs532598310 A/G 143404 N.D. N.D.
ss4366335165 rs1211274181 A/G 143404 N.D. N.D.
ss4366335166 v3_novel_345000027 C/T 143404 N.D. N.D.
ss4366335167 rs1262995443 A/C 143404 N.D. N.D.
ss4366335168 rs1240426856 C/T 143404 N.D. N.D.
ss4366335169 rs1325525367 A/G 143404 N.D. N.D.
30 of 15000000 subsnp's starting at ss2137544145. ss# starting at ss