NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:TOPMED
Submitter Batch ID:Freeze 8 variant calls-chr22
Submitter Method ID:FREEZE 8
Citation:not supplied
Population:freeze 8 samples
Comment:not supplied
Batch Total SubSNP(ss) Count:9393402


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137544171 TOPMed_freeze_8?chr22_10,510,227 A/G 264690 N.D. N.D.
ss5103890628 TOPMed_freeze_8?chr22_10,510,277 -/AGTGGGCGGATCACTTGAGGTCAGG 264690 N.D. N.D.
ss5103890629 TOPMed_freeze_8?chr22_10,510,497 A/G 264690 N.D. N.D.
ss5103890630 TOPMed_freeze_8?chr22_10,510,507 -/CA 264690 N.D. N.D.
ss5103890631 TOPMed_freeze_8?chr22_10,510,519 A/G 264690 N.D. N.D.
ss5103890632 TOPMed_freeze_8?chr22_10,510,750 A/T 264690 N.D. N.D.
ss5103890633 TOPMed_freeze_8?chr22_10,510,830 -/A 264690 N.D. N.D.
ss5103890634 TOPMed_freeze_8?chr22_10,510,849 A/C 264690 N.D. N.D.
ss5103890635 TOPMed_freeze_8?chr22_10,511,139 -/C 264690 N.D. N.D.
ss5103890636 TOPMed_freeze_8?chr22_10,511,267 A/T 264690 N.D. N.D.
ss5103890637 TOPMed_freeze_8?chr22_10,511,317 -/T 264690 N.D. N.D.
ss5103890638 TOPMed_freeze_8?chr22_10,511,324 A/G 264690 N.D. N.D.
ss5103890639 TOPMed_freeze_8?chr22_10,511,349 -/T 264690 N.D. N.D.
ss5103890640 TOPMed_freeze_8?chr22_10,511,359-02 -/AA 264690 N.D. N.D.
ss5103890641 TOPMed_freeze_8?chr22_10,511,361 A/C 264690 N.D. N.D.
ss5103890642 TOPMed_freeze_8?chr22_10,511,371 A/T 264690 N.D. N.D.
ss5103890643 TOPMed_freeze_8?chr22_10,511,385 A/G 264690 N.D. N.D.
ss5103890644 TOPMed_freeze_8?chr22_10,511,393 -/TCCAGTAT 264690 N.D. N.D.
ss5103890645 TOPMed_freeze_8?chr22_10,511,409-01 A/G 264690 N.D. N.D.
ss5103890646 TOPMed_freeze_8?chr22_10,511,437 C/T 264690 N.D. N.D.
ss5103890647 TOPMed_freeze_8?chr22_10,511,441 A/C 264690 N.D. N.D.
ss5103890648 TOPMed_freeze_8?chr22_10,511,458 C/G 264690 N.D. N.D.
ss5103890649 TOPMed_freeze_8?chr22_10,511,498 A/G 264690 N.D. N.D.
ss5103890650 TOPMed_freeze_8?chr22_10,511,692 A/G 264690 N.D. N.D.
ss5103890651 TOPMed_freeze_8?chr22_10,513,407 A/C 264690 N.D. N.D.
ss5103890652 TOPMed_freeze_8?chr22_10,513,650-02 G/T 264690 N.D. N.D.
ss5103890653 TOPMed_freeze_8?chr22_10,513,759 C/G 264690 N.D. N.D.
ss5103890654 TOPMed_freeze_8?chr22_10,513,825 C/T 264690 N.D. N.D.
ss5103890655 TOPMed_freeze_8?chr22_10,513,831 A/G 264690 N.D. N.D.
ss5103890656 TOPMed_freeze_8?chr22_10,513,904 C/T 264690 N.D. N.D.
30 of 9393402 subsnp's starting at ss2137544171. ss# starting at ss