NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:TOMMO_GENOMICS
Submitter Batch ID:PANEL_8.3KJPN_GRCh37
Submitter Method ID:10.5281/ZENODO.4047311
Citation:3.5KJPNv2: an allele frequency panel of 3552 Japanese individuals including the X chromosome
Population:Japanese
Comment:Ask for permission to dist [AT] megabank [DOT] tohoku [DOT] ac [DOT] jp prior to the use of the data for commercial purpose.
Batch Total SubSNP(ss) Count:94822731


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137544178 1:10108_CAACCCT_C -/AACCCT 16760 N.D. N.D.
ss5142030695 1:10109_AACCCT_A -/ACCCT 16760 N.D. N.D.
ss5142030696 1:10116_ACCCTAACCCTAACCCTAACCCTAACCCTAAC_A -/CCCTAACCCTAACCCTAACCCTAACCCTAAC 16760 N.D. N.D.
ss5142030697 1:10134_ACCCTAACCCTAAC_A -/CCCTAACCCTAAC 16760 N.D. N.D.
ss5142030698 1:10137_CTAACCCTAACCCCT_C -/TAACCCTAACCCCT 16760 N.D. N.D.
ss5142030699 1:10140_ACCCTAAC_A -/CCCTAAC 16760 N.D. N.D.
ss5142030700 1:10143_CTAACCCCT_C -/TAACCCCT 16760 N.D. N.D.
ss5142030701 1:10144_TA_T -/A 16760 N.D. N.D.
ss5142030702 1:10145_AAC_A -/AC 16760 N.D. N.D.
ss5142030703 1:10146_AC_A -/C 16760 N.D. N.D.
ss5142030704 1:10149_CCT_C -/CT 16760 N.D. N.D.
ss5142030705 1:10150_C_T C/T 16760 N.D. N.D.
ss5142030706 1:10150_CT_C -/T 16760 N.D. N.D.
ss5142030707 1:10151_TA_T -/A 16760 N.D. N.D.
ss5142030708 1:10152_A_C A/C 16760 N.D. N.D.
ss5142030709 1:10153_A_G A/G 16760