NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:1000GENOMES
Submitter Batch ID:30x_grch38
Submitter Method ID:SEQ
Citation:not supplied
Comment:not supplied
Batch Total SubSNP(ss) Count:73534166


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss2137544265 1:10390:CCCCTAACCC:C -/CCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA 6404 N.D. N.D.
ss5240854476 1:10397:CCCCTAA:C -/CCCTAA 6404 N.D. N.D.
ss5240854477 1:10398:C:CCCCTAA -/CCCTAA 6404 N.D. N.D.
ss5240854478 1:10399:C:A A/C 6404 N.D. N.D.
ss5240854479 1:10403:A:ACCCTAACCC -/CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC 6404 N.D. N.D.
ss5240854480 1:10404:ACCCTAACCC:A -/CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC 6404 N.D. N.D.
ss5240854481 1:10405:A:AC -/C 6404 N.D. N.D.
ss5240854482 1:10415:ACCCTAACCC:A -/CCCTAACCCTAACCCTAACCCTAAC 6404 N.D. N.D.
ss5240854483 1:10420:A:C A/C 6404 N.D. N.D.
ss5240854484 1:10421:ACCCTAACCC:A -/CCCTAACCCTAACCCTAAC 6404 N.D. N.D.
ss5240854485 1:10422:CCCTAA:C -/CCTAA 6404 N.D. N.D.
ss5240854486 1:10427:ACCCT:A -/CCCT 6404 N.D. N.D.
ss5240854487 1:10428:CCCTAA:C -/CCTAA 6404 N.D. N.D.
ss5240854488 1:10430:C:CT -/T 6404 N.D. N.D.
ss5240854489 1:10433:A:ACCCCTAAC -/CCCCTAAC 6404 N.D. N.D.
ss5240854490 1:10434:A:AC -/C 6404 N.D. N.D.
ss5240854491