NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:EGP_SNPS
Submitter Batch ID:CDC34-PDR90-061404
Submitter Method ID:METHOD-E
Citation:NIEHS-SNPs, Environmental Genome Project, NIEHS ES15478.
Population:PDR90
Comment:These SNPs were generated as part of the NIEHS supported grant (HL66682) for the Environmental Genome Project to develop SNP resources distributed to the research community. Please see egp.gs.washington.edu for details on how to cite this work. The first descriptor in the "Submitter SNP ID:" field indicates the HUGO assigned name of the gene studied. The second number denotes the variant base position in the listed GenBank accession number.
Batch Total SubSNP(ss) Count:188


SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss24821101 CDC34-000143 C/G 180 rs16990492 0 19 529875 NT_011295.12 469875
ss24821102 CDC34-000206 A/C 180 rs16990493 0 19 529938 NT_011295.12 469938
ss24821103 CDC34-000377 A/G 176 rs16990494 0 19 530109 NT_011295.12 470109
ss24821104 CDC34-000408 G/T 178 rs16990496 0 19 530140 NT_011295.12 470140
ss24821105 CDC34-000824 A/C 180 rs16990498 0 19 530556 NT_011295.12 470556
ss24821106 CDC34-000992 A/G 176 rs16989712 0 19 530724 NT_011295.12 470724
ss24821107 CDC34-001075 C/G 170 rs16989717 0 19 530807 NT_011295.12 470807
ss24821108 CDC34-001184 A/T 178 rs16989721 0 19 530916 NT_011295.12 470916
ss24821109 CDC34-001383 C/T 178 rs16989724 0 19 531115 NT_011295.12 471115
ss24821110 CDC34-001425 C/G 178 rs16989726 0 19 531157 NT_011295.12 471157
ss24821111 CDC34-001437 C/G 180 rs16989728 0 19 531169 NT_011295.12 471169
ss24821112 CDC34-001724 C/T 178 rs16989730 0 19 531456 NT_011295.12 471456
ss24821113 CDC34-001741 C/T 178 rs16989733 0 19 531473 NT_011295.12 471473
ss24821114 CDC34-001769 A/G 178 rs16989736 0 19 531501 NT_011295.12 471501
ss24821115 CDC34-001798 A/C 178 rs16989739 0 19 531530 NT_011295.12 471530
ss24821116 CDC34-001805 C/T 178 rs16989741 0 19 531537 NT_011295.12 471537
ss24821117 CDC34-001814 A/C 178 rs16989743 0 19 531546 NT_011295.12 471546
ss24821118 CDC34-001815 A/G 178 rs16989748 0 19 531547 NT_011295.12 471547
ss24821119 CDC34-001844 C/T 176 rs17425535 0 19 531576 NT_011295.12 471576
ss24821120 CDC34-001862 A/G 174 rs17425542 0 19 531594 NT_011295.12 471594
ss24821121 CDC34-001866 C/G 174 rs17425549 0 19 531598 NT_011295.12 471598
ss24821122 CDC34-001893 A/G 174 rs16989750 0 19 531625 NT_011295.12 471625
ss24821124 CDC34-002004 A/C 160 rs16989752 0 19 531736 NT_011295.12 471736
ss24821125 CDC34-002086 C/G 122 rs16989755 0 19 531818 NT_011295.12 471818
ss24821126 CDC34-002334 C/T 148 rs6507 0 19 532066 NT_011295.12 472066
ss24821127 CDC34-002452 A/G 170 rs16989771 0 19 532184 NT_011295.12 472184
ss24821128 CDC34-002536 G/T 166 rs16990500 0 19 532268 NT_011295.12 472268
ss24821129 CDC34-002605 C/T 166 rs16990502 0 19 532337 NT_011295.12 472337
ss24821130 CDC34-002615 C/T 170 rs12985200 0 19 532347 NT_011295.12 472347
ss24821123 CDC34-001918 -/ACCTGGCCGCGGAGCGCAGGCGCAGTCGG 164 rs869082403 0 N.D. N.D.
30 of 188 subsnp's starting at ss24821101. ss# starting at ss

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement