Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 36424

1.

rs1491587944 has merged into rs10609753 [Homo sapiens]
    Variant type:
    DELINS
    Alleles:
    AAAAA>-,A,AA,AAA,AAAA,AAAAAA,AAAAAAA,AAAAAAAA,AAAAAAAAA [Show Flanks]
    Chromosome:
    5:78608599 (GRCh38)
    5:77904422 (GRCh37)
    Canonical SPDI:
    NC_000005.10:78608588:AAAAAAAAAAAAAAA:AAAAAAAAAA,NC_000005.10:78608588:AAAAAAAAAAAAAAA:AAAAAAAAAAA,NC_000005.10:78608588:AAAAAAAAAAAAAAA:AAAAAAAAAAAA,NC_000005.10:78608588:AAAAAAAAAAAAAAA:AAAAAAAAAAAAA,NC_000005.10:78608588:AAAAAAAAAAAAAAA:AAAAAAAAAAAAAA,NC_000005.10:78608588:AAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAA,NC_000005.10:78608588:AAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAA,NC_000005.10:78608588:AAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAA,NC_000005.10:78608588:AAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAA
    Gene:
    LHFPL2 (Varview)
    Functional Consequence:
    intron_variant,genic_upstream_transcript_variant
    Validated:
    by frequency,by alfa,by cluster
    MAF:
    AAAAAAAAAAA=0./0 (ALFA)
    HGVS:
    2.

    rs1491537185 [Homo sapiens]
      Variant type:
      DELINS
      Alleles:
      GA>- [Show Flanks]
      Chromosome:
      5:78562700 (GRCh38)
      5:77858523 (GRCh37)
      Canonical SPDI:
      NC_000005.10:78562698:AGA:A
      Gene:
      LHFPL2 (Varview)
      Functional Consequence:
      intron_variant,genic_upstream_transcript_variant
      Validated:
      by frequency,by alfa,by cluster
      MAF:
      A=0./0 (ALFA)
      HGVS:
      3.

      rs1491535305 [Homo sapiens]
        Variant type:
        DEL
        Alleles:
        CA>- [Show Flanks]
        Chromosome:
        5:78628552 (GRCh38)
        5:77924375 (GRCh37)
        Canonical SPDI:
        NC_000005.10:78628551:CA:
        Gene:
        LHFPL2 (Varview)
        Functional Consequence:
        intron_variant,genic_upstream_transcript_variant
        Validated:
        by frequency,by alfa,by cluster
        MAF:
        -=0.000071/1 (ALFA)
        -=0.000007/1 (GnomAD)
        -=0.000019/5 (TOPMED)
        HGVS:
        4.

        rs1491520844 has merged into rs11323839 [Homo sapiens]
          Variant type:
          DELINS
          Alleles:
          AAAA>-,A,AA,AAA,AAAAA [Show Flanks]
          Chromosome:
          5:78511114 (GRCh38)
          5:77806937 (GRCh37)
          Canonical SPDI:
          NC_000005.10:78511105:AAAAAAAAAAAA:AAAAAAAA,NC_000005.10:78511105:AAAAAAAAAAAA:AAAAAAAAA,NC_000005.10:78511105:AAAAAAAAAAAA:AAAAAAAAAA,NC_000005.10:78511105:AAAAAAAAAAAA:AAAAAAAAAAA,NC_000005.10:78511105:AAAAAAAAAAAA:AAAAAAAAAAAAA
          Gene:
          LHFPL2 (Varview)
          Functional Consequence:
          intron_variant
          Validated:
          by frequency,by alfa,by cluster
          MAF:
          AAAAAAAAA=0./0 (ALFA)
          A=0.3/12 (GENOME_DK)
          A=0.4064/243 (NorthernSweden)
          A=0.4469/2238 (1000Genomes)
          HGVS:
          5.

          rs1491509088 [Homo sapiens]
            Variant type:
            DEL
            Alleles:
            CG>- [Show Flanks]
            Chromosome:
            5:78544770 (GRCh38)
            5:77840593 (GRCh37)
            Canonical SPDI:
            NC_000005.10:78544769:CG:
            Gene:
            LHFPL2 (Varview)
            Functional Consequence:
            intron_variant
            Validated:
            by frequency,by alfa,by cluster
            MAF:
            -=0./0 (ALFA)
            -=0.000029/4 (GnomAD)
            HGVS:
            6.

            rs1491467251 [Homo sapiens]
              Variant type:
              DELINS
              Alleles:
              TA>- [Show Flanks]
              Chromosome:
              5:78503054 (GRCh38)
              5:77798877 (GRCh37)
              Canonical SPDI:
              NC_000005.10:78503052:ATA:A
              Gene:
              LHFPL2 (Varview)
              Functional Consequence:
              intron_variant
              Validated:
              by frequency,by cluster
              MAF:
              -=0.0124/46 (TWINSUK)
              -=0.0156/60 (ALSPAC)
              HGVS:
              7.

              rs1491447794 has merged into rs34179854 [Homo sapiens]
                Variant type:
                DELINS
                Alleles:
                AAAAAAAA>-,A,AA,AAA,AAAA,AAAAA,AAAAAA,AAAAAAA,AAAAAAAAA,AAAAAAAAAA,AAAAAAAAAAA,AAAAAAAAAAAA,AAAAAAAAAAAAA,AAAAAAAAAAAAAA,AAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAA [Show Flanks]
                Chromosome:
                5:78524756 (GRCh38)
                5:77820579 (GRCh37)
                Canonical SPDI:
                NC_000005.10:78524742:AAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAA,NC_000005.10:78524742:AAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAA,NC_000005.10:78524742:AAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAA,NC_000005.10:78524742:AAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAA,NC_000005.10:78524742:AAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAA,NC_000005.10:78524742:AAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAA,NC_000005.10:78524742:AAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAA,NC_000005.10:78524742:AAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAA,NC_000005.10:78524742:AAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAA,NC_000005.10:78524742:AAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAA,NC_000005.10:78524742:AAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAA,NC_000005.10:78524742:AAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAA,NC_000005.10:78524742:AAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAA,NC_000005.10:78524742:AAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAA,NC_000005.10:78524742:AAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAAA,NC_000005.10:78524742:AAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                Gene:
                LHFPL2 (Varview)
                Functional Consequence:
                intron_variant
                Validated:
                by frequency,by alfa,by cluster
                MAF:
                AAAAAAAAAAAAAA=0./0 (ALFA)
                HGVS:
                NC_000005.10:g.78524756_78524763del, NC_000005.10:g.78524757_78524763del, NC_000005.10:g.78524758_78524763del, NC_000005.10:g.78524759_78524763del, NC_000005.10:g.78524760_78524763del, NC_000005.10:g.78524761_78524763del, NC_000005.10:g.78524762_78524763del, NC_000005.10:g.78524763del, NC_000005.10:g.78524763dup, NC_000005.10:g.78524762_78524763dup, NC_000005.10:g.78524761_78524763dup, NC_000005.10:g.78524760_78524763dup, NC_000005.10:g.78524759_78524763dup, NC_000005.10:g.78524758_78524763dup, NC_000005.10:g.78524757_78524763dup, NC_000005.10:g.78524756_78524763dup, NC_000005.9:g.77820579_77820586del, NC_000005.9:g.77820580_77820586del, NC_000005.9:g.77820581_77820586del, NC_000005.9:g.77820582_77820586del, NC_000005.9:g.77820583_77820586del, NC_000005.9:g.77820584_77820586del, NC_000005.9:g.77820585_77820586del, NC_000005.9:g.77820586del, NC_000005.9:g.77820586dup, NC_000005.9:g.77820585_77820586dup, NC_000005.9:g.77820584_77820586dup, NC_000005.9:g.77820583_77820586dup, NC_000005.9:g.77820582_77820586dup, NC_000005.9:g.77820581_77820586dup, NC_000005.9:g.77820580_77820586dup, NC_000005.9:g.77820579_77820586dup
                8.

                rs1491419287 [Homo sapiens]
                  Variant type:
                  DELINS
                  Alleles:
                  ->GTT [Show Flanks]
                  Chromosome:
                  5:78527364 (GRCh38)
                  5:77823188 (GRCh37)
                  Canonical SPDI:
                  NC_000005.10:78527364:TT:TTGTT
                  Gene:
                  LHFPL2 (Varview)
                  Functional Consequence:
                  intron_variant
                  Validated:
                  by frequency,by alfa
                  MAF:
                  TTGTT=0./0 (ALFA)
                  HGVS:
                  9.

                  rs1491400228 [Homo sapiens]
                    Variant type:
                    DELINS
                    Alleles:
                    ->CACACACACAAA,CACACACACACACACACACATA,CACACACACACACACATA,CACACACACACACATA,CACACACACACATA,CACACACACATA,CACACACATA,CACACATA,CACATA [Show Flanks]
                    Chromosome:
                    5:78641938 (GRCh38)
                    5:77937762 (GRCh37)
                    Canonical SPDI:
                    NC_000005.10:78641938:A:ACACACACACAAA,NC_000005.10:78641938:A:ACACACACACACACACACACATA,NC_000005.10:78641938:A:ACACACACACACACACATA,NC_000005.10:78641938:A:ACACACACACACACATA,NC_000005.10:78641938:A:ACACACACACACATA,NC_000005.10:78641938:A:ACACACACACATA,NC_000005.10:78641938:A:ACACACACATA,NC_000005.10:78641938:A:ACACACATA,NC_000005.10:78641938:A:ACACATA
                    Gene:
                    LHFPL2 (Varview)
                    Functional Consequence:
                    intron_variant,genic_upstream_transcript_variant
                    Validated:
                    by frequency,by alfa,by cluster
                    MAF:
                    ACACACACACACACACATA=0./0 (ALFA)
                    ACACACACAT=0.000004/1 (TOPMED)
                    ACACACACACACACACACACAT=0.000119/2 (TOMMO)
                    HGVS:
                    10.

                    rs1491318387 has merged into rs35135294 [Homo sapiens]
                      Variant type:
                      DELINS
                      Alleles:
                      TTTTTTTTTTTT>-,T,TTT,TTTT,TTTTT,TTTTTT,TTTTTTT,TTTTTTTT,TTTTTTTTT,TTTTTTTTTT,TTTTTTTTTTT,TTTTTTTTTTTTT,TTTTTTTTTTTTTT,TTTTTTTTTTTTTTT,TTTTTTTTTTTTTTTT,TTTTTTTTTTTTTTTTT,TTTTTTTTTTTTTTTTTT,TTTTTTTTTTTTTTTTTTT,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT [Show Flanks]
                      Chromosome:
                      5:78527375 (GRCh38)
                      5:77823198 (GRCh37)
                      Canonical SPDI:
                      NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT,NC_000005.10:78527363:TTTTTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
                      Gene:
                      LHFPL2 (Varview)
                      Functional Consequence:
                      intron_variant
                      Validated:
                      by frequency,by alfa,by cluster
                      MAF:
                      TTTTTTTTTTT=0./0 (ALFA)
                      HGVS:
                      NC_000005.10:g.78527375_78527386del, NC_000005.10:g.78527376_78527386del, NC_000005.10:g.78527378_78527386del, NC_000005.10:g.78527379_78527386del, NC_000005.10:g.78527380_78527386del, NC_000005.10:g.78527381_78527386del, NC_000005.10:g.78527382_78527386del, NC_000005.10:g.78527383_78527386del, NC_000005.10:g.78527384_78527386del, NC_000005.10:g.78527385_78527386del, NC_000005.10:g.78527386del, NC_000005.10:g.78527386dup, NC_000005.10:g.78527385_78527386dup, NC_000005.10:g.78527384_78527386dup, NC_000005.10:g.78527383_78527386dup, NC_000005.10:g.78527382_78527386dup, NC_000005.10:g.78527381_78527386dup, NC_000005.10:g.78527380_78527386dup, NC_000005.10:g.78527386_78527387insTTTTTTTTTTTTTTTTTTTTTTTTT, NC_000005.9:g.77823198_77823209del, NC_000005.9:g.77823199_77823209del, NC_000005.9:g.77823201_77823209del, NC_000005.9:g.77823202_77823209del, NC_000005.9:g.77823203_77823209del, NC_000005.9:g.77823204_77823209del, NC_000005.9:g.77823205_77823209del, NC_000005.9:g.77823206_77823209del, NC_000005.9:g.77823207_77823209del, NC_000005.9:g.77823208_77823209del, NC_000005.9:g.77823209del, NC_000005.9:g.77823209dup, NC_000005.9:g.77823208_77823209dup, NC_000005.9:g.77823207_77823209dup, NC_000005.9:g.77823206_77823209dup, NC_000005.9:g.77823205_77823209dup, NC_000005.9:g.77823204_77823209dup, NC_000005.9:g.77823203_77823209dup, NC_000005.9:g.77823209_77823210insTTTTTTTTTTTTTTTTTTTTTTTTT
                      11.

                      rs1491304544 has merged into rs56911011 [Homo sapiens]
                        Variant type:
                        DELINS
                        Alleles:
                        CACACACACACACACACACACACACACACACA>-,CA,CACA,CACACA,CACACACA,CACACACACA,CACACACACACA,CACACACACACACA,CACACACACACACACA,CACACACACACACACACA,CACACACACACACACACACA,CACACACACACACACACACACA,CACACACACACACACACACACACA,CACACACACACACACACACACACACA,CACACACACACACACACACACACACACA,CACACACACACACACACACACACACACACA,CACACACACACACACACACACACACACACACACA,CACACACACACACACACACACACACACACACACACA,CACACACACACACACACACACACACACACACACACACA,CACACACACACACACACACACACACACACACACACACACA,CACACACACACACACACACACACACACACACACACACACACA,CACACACACACACACACACACACACACACACACACACACACACA [Show Flanks]
                        Chromosome:
                        5:78645561 (GRCh38)
                        5:77941384 (GRCh37)
                        Canonical SPDI:
                        NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACACACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACACACACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACACACACACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACACACACACACACACACACACACACACACACACA,NC_000005.10:78645543:ACACACACACACACACACACACACACACACACACACACACACACACACA:ACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACA
                        Gene:
                        LHFPL2 (Varview)
                        Functional Consequence:
                        intron_variant,genic_upstream_transcript_variant
                        Validated:
                        by frequency,by alfa,by cluster
                        MAF:
                        ACACACACACACACACACA=0./0 (ALFA)
                        HGVS:
                        NC_000005.10:g.78645545CA[8], NC_000005.10:g.78645545CA[9], NC_000005.10:g.78645545CA[10], NC_000005.10:g.78645545CA[11], NC_000005.10:g.78645545CA[12], NC_000005.10:g.78645545CA[13], NC_000005.10:g.78645545CA[14], NC_000005.10:g.78645545CA[15], NC_000005.10:g.78645545CA[16], NC_000005.10:g.78645545CA[17], NC_000005.10:g.78645545CA[18], NC_000005.10:g.78645545CA[19], NC_000005.10:g.78645545CA[20], NC_000005.10:g.78645545CA[21], NC_000005.10:g.78645545CA[22], NC_000005.10:g.78645545CA[23], NC_000005.10:g.78645545CA[25], NC_000005.10:g.78645545CA[26], NC_000005.10:g.78645545CA[27], NC_000005.10:g.78645545CA[28], NC_000005.10:g.78645545CA[29], NC_000005.10:g.78645545CA[30], NC_000005.9:g.77941368CA[8], NC_000005.9:g.77941368CA[9], NC_000005.9:g.77941368CA[10], NC_000005.9:g.77941368CA[11], NC_000005.9:g.77941368CA[12], NC_000005.9:g.77941368CA[13], NC_000005.9:g.77941368CA[14], NC_000005.9:g.77941368CA[15], NC_000005.9:g.77941368CA[16], NC_000005.9:g.77941368CA[17], NC_000005.9:g.77941368CA[18], NC_000005.9:g.77941368CA[19], NC_000005.9:g.77941368CA[20], NC_000005.9:g.77941368CA[21], NC_000005.9:g.77941368CA[22], NC_000005.9:g.77941368CA[23], NC_000005.9:g.77941368CA[25], NC_000005.9:g.77941368CA[26], NC_000005.9:g.77941368CA[27], NC_000005.9:g.77941368CA[28], NC_000005.9:g.77941368CA[29], NC_000005.9:g.77941368CA[30]
                        12.

                        rs1491260246 [Homo sapiens]
                          Variant type:
                          DEL
                          Alleles:
                          GT>- [Show Flanks]
                          Chromosome:
                          5:78570650 (GRCh38)
                          5:77866473 (GRCh37)
                          Canonical SPDI:
                          NC_000005.10:78570649:GT:
                          Gene:
                          LHFPL2 (Varview)
                          Functional Consequence:
                          intron_variant,genic_upstream_transcript_variant
                          Validated:
                          by frequency,by alfa,by cluster
                          MAF:
                          -=0./0 (ALFA)
                          -=0.000045/6 (GnomAD)
                          -=0.001074/18 (TOMMO)
                          -=0.001638/3 (Korea1K)
                          HGVS:
                          13.

                          rs1491256060 [Homo sapiens]
                            Variant type:
                            DELINS
                            Alleles:
                            CT>- [Show Flanks]
                            Chromosome:
                            5:78491303 (GRCh38)
                            5:77787126 (GRCh37)
                            Canonical SPDI:
                            NC_000005.10:78491298:CTCTCT:CTCT
                            Gene:
                            LHFPL2 (Varview)
                            Functional Consequence:
                            intron_variant
                            Validated:
                            by frequency,by alfa,by cluster
                            MAF:
                            CTCT=0./0 (ALFA)
                            -=0.000007/1 (GnomAD)
                            -=0.000011/3 (TOPMED)
                            HGVS:
                            14.

                            rs1491241802 has merged into rs141035370 [Homo sapiens]
                              Variant type:
                              DELINS
                              Alleles:
                              ->GT [Show Flanks]
                              Chromosome:
                              5:78570649 (GRCh38)
                              5:77866473 (GRCh37)
                              Canonical SPDI:
                              NC_000005.10:78570649:GT:GTGT
                              Gene:
                              LHFPL2 (Varview)
                              Functional Consequence:
                              intron_variant,genic_upstream_transcript_variant
                              Validated:
                              by frequency,by alfa,by cluster
                              MAF:
                              GTGT=0.000071/1 (ALFA)
                              GT=0.000144/19 (GnomAD)
                              GT=0.000519/2 (ALSPAC)
                              GT=0.001348/5 (TWINSUK)
                              HGVS:
                              15.

                              rs1491236644 has merged into rs368470431 [Homo sapiens]
                                Variant type:
                                DELINS
                                Alleles:
                                TA>-,TATA,TATACGTATATATATAGTATATATATATATACGTATATATATATATATA,TATACGTATATATATATATATA,TATATA,TATATATA [Show Flanks]
                                Chromosome:
                                5:78570663 (GRCh38)
                                5:77866486 (GRCh37)
                                Canonical SPDI:
                                NC_000005.10:78570650:TATATATATATATA:TATATATATATA,NC_000005.10:78570650:TATATATATATATA:TATATATATATATATA,NC_000005.10:78570650:TATATATATATATA:TATATATATATATATACGTATATATATAGTATATATATATATACGTATATATATATATATA,NC_000005.10:78570650:TATATATATATATA:TATATATATATATATACGTATATATATATATATA,NC_000005.10:78570650:TATATATATATATA:TATATATATATATATATA,NC_000005.10:78570650:TATATATATATATA:TATATATATATATATATATA
                                Gene:
                                LHFPL2 (Varview)
                                Functional Consequence:
                                intron_variant,genic_upstream_transcript_variant
                                Validated:
                                by frequency,by alfa,by cluster
                                MAF:
                                TATATATATATATATATA=0./0 (ALFA)
                                TATATA=0.000004/1 (TOPMED)
                                -=0.000418/7 (TOMMO)
                                -=0.002186/4 (Korea1K)
                                -=0.003333/2 (NorthernSweden)
                                -=0.006012/6 (GoNL)
                                HGVS:
                                16.

                                rs1491235364 [Homo sapiens]
                                  Variant type:
                                  DELINS
                                  Alleles:
                                  CT>- [Show Flanks]
                                  Chromosome:
                                  5:78596819 (GRCh38)
                                  5:77892642 (GRCh37)
                                  Canonical SPDI:
                                  NC_000005.10:78596817:TCT:T
                                  Gene:
                                  LHFPL2 (Varview)
                                  Functional Consequence:
                                  intron_variant,genic_upstream_transcript_variant
                                  Validated:
                                  by frequency,by cluster
                                  MAF:
                                  -=0.0113/42 (TWINSUK)
                                  -=0.0114/44 (ALSPAC)
                                  HGVS:
                                  17.

                                  rs1491231357 [Homo sapiens]
                                    Variant type:
                                    DELINS
                                    Alleles:
                                    ->CACACACATATATATATA [Show Flanks]
                                    Chromosome:
                                    5:78572499 (GRCh38)
                                    5:77868323 (GRCh37)
                                    Canonical SPDI:
                                    NC_000005.10:78572499:ATATATATATA:ATATATATATACACACACATATATATATA
                                    Gene:
                                    LHFPL2 (Varview)
                                    Functional Consequence:
                                    intron_variant,genic_upstream_transcript_variant
                                    Validated:
                                    by frequency,by alfa,by cluster
                                    MAF:
                                    ATATATATATACACACACATATATATATA=0./0 (ALFA)
                                    ATATATATATACACACAC=0.000004/1 (TOPMED)
                                    ATATATATATACACACAC=0.000027/1 (GnomAD)
                                    HGVS:
                                    18.

                                    rs1491221784 [Homo sapiens]
                                      Variant type:
                                      INS
                                      Alleles:
                                      ->CA [Show Flanks]
                                      Chromosome:
                                      5:78644948 (GRCh38)
                                      5:77940772 (GRCh37)
                                      Canonical SPDI:
                                      NC_000005.10:78644948::CA
                                      Gene:
                                      LHFPL2 (Varview)
                                      Functional Consequence:
                                      intron_variant,genic_upstream_transcript_variant
                                      Validated:
                                      by frequency,by alfa,by cluster
                                      MAF:
                                      CA=0.000224/1 (ALFA)
                                      CA=0.000223/1 (Estonian)
                                      CA=0.000513/72 (GnomAD)
                                      CA=0.001667/1 (NorthernSweden)
                                      HGVS:
                                      19.

                                      rs1491180743 has merged into rs3068900 [Homo sapiens]
                                        Variant type:
                                        DELINS
                                        Alleles:
                                        CACACA>-,CA,CACA,CACACACA,CACACACACA,CACACACACACA,CACACACACACACA,CACACACACACACACA [Show Flanks]
                                        Chromosome:
                                        5:78592635 (GRCh38)
                                        5:77888458 (GRCh37)
                                        Canonical SPDI:
                                        NC_000005.10:78592621:ACACACACACACACACACA:ACACACACACACA,NC_000005.10:78592621:ACACACACACACACACACA:ACACACACACACACA,NC_000005.10:78592621:ACACACACACACACACACA:ACACACACACACACACA,NC_000005.10:78592621:ACACACACACACACACACA:ACACACACACACACACACACA,NC_000005.10:78592621:ACACACACACACACACACA:ACACACACACACACACACACACA,NC_000005.10:78592621:ACACACACACACACACACA:ACACACACACACACACACACACACA,NC_000005.10:78592621:ACACACACACACACACACA:ACACACACACACACACACACACACACA,NC_000005.10:78592621:ACACACACACACACACACA:ACACACACACACACACACACACACACACA
                                        Gene:
                                        LHFPL2 (Varview)
                                        Functional Consequence:
                                        intron_variant,genic_upstream_transcript_variant
                                        Validated:
                                        by frequency,by alfa,by cluster
                                        MAF:
                                        ACACACACACACACA=0./0 (ALFA)
                                        -=0.0012/20 (TOMMO)
                                        AC=0.30571/1531 (1000Genomes)
                                        HGVS:
                                        20.

                                        rs1491104728 has merged into rs11445485 [Homo sapiens]
                                          Variant type:
                                          DELINS
                                          Alleles:
                                          AAAAAAA>-,AAA,AAAA,AAAAA,AAAAAA,AAAAAAAA,AAAAAAAAA,AAAAAAAAAA,AAAAAAAAAAAAAAAA [Show Flanks]
                                          Chromosome:
                                          5:78531433 (GRCh38)
                                          5:77827256 (GRCh37)
                                          Canonical SPDI:
                                          NC_000005.10:78531419:AAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAA,NC_000005.10:78531419:AAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAA,NC_000005.10:78531419:AAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAA,NC_000005.10:78531419:AAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAA,NC_000005.10:78531419:AAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAA,NC_000005.10:78531419:AAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAA,NC_000005.10:78531419:AAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAA,NC_000005.10:78531419:AAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAA,NC_000005.10:78531419:AAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                          Gene:
                                          LHFPL2 (Varview)
                                          Functional Consequence:
                                          intron_variant
                                          Validated:
                                          by frequency,by alfa,by cluster
                                          MAF:
                                          AAAAAAAAAAAAAAAA=0./0 (ALFA)
                                          -=0.000102/27 (TOPMED)
                                          HGVS:

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center