Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 7232

1.

rs1491300471 [Homo sapiens]
    Variant type:
    DELINS
    Alleles:
    ->GTATATATATAT [Show Flanks]
    Chromosome:
    7:23275392 (GRCh38)
    7:23315012 (GRCh37)
    Canonical SPDI:
    NC_000007.14:23275392:TATATATATAT:TATATATATATGTATATATATAT
    Gene:
    GPNMB (Varview)
    Functional Consequence:
    downstream_transcript_variant,500B_downstream_variant
    Validated:
    by frequency,by alfa
    MAF:
    TATATATATATGTATATATATAT=0.00008/1 (ALFA)
    HGVS:
    2.

    rs1491156116 has merged into rs56692068 [Homo sapiens]
      Variant type:
      DELINS
      Alleles:
      ATATATATATATATATATATATATATATATATATATATATATAT>-,AT,ATAT,ATATAT,ATATATAT,ATATATATAT,ATATATATATAT,ATATATATATATAT,ATATATATATATATAT,ATATATATATATATATAT,ATATATATATATATATATAT,ATATATATATATATATATATAT,ATATATATATATATATATATATAT,ATATATATATATATATATATATATAT,ATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT [Show Flanks]
      Chromosome:
      7:23275400 (GRCh38)
      7:23315019 (GRCh37)
      Canonical SPDI:
      NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT,NC_000007.14:23275391:ATATATATATATATATATATATATATATATATATATATATATATATATATAT:ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT
      Gene:
      GPNMB (Varview)
      Functional Consequence:
      500B_downstream_variant,downstream_transcript_variant
      Validated:
      by frequency,by alfa,by cluster
      MAF:
      ATATATAT=0./0 (ALFA)
      HGVS:
      NC_000007.14:g.23275392AT[4], NC_000007.14:g.23275392AT[5], NC_000007.14:g.23275392AT[6], NC_000007.14:g.23275392AT[7], NC_000007.14:g.23275392AT[8], NC_000007.14:g.23275392AT[9], NC_000007.14:g.23275392AT[10], NC_000007.14:g.23275392AT[11], NC_000007.14:g.23275392AT[12], NC_000007.14:g.23275392AT[13], NC_000007.14:g.23275392AT[14], NC_000007.14:g.23275392AT[15], NC_000007.14:g.23275392AT[16], NC_000007.14:g.23275392AT[17], NC_000007.14:g.23275392AT[18], NC_000007.14:g.23275392AT[19], NC_000007.14:g.23275392AT[20], NC_000007.14:g.23275392AT[21], NC_000007.14:g.23275392AT[22], NC_000007.14:g.23275392AT[23], NC_000007.14:g.23275392AT[24], NC_000007.14:g.23275392AT[25], NC_000007.14:g.23275392AT[27], NC_000007.14:g.23275392AT[28], NC_000007.14:g.23275392AT[29], NC_000007.14:g.23275392AT[30], NC_000007.14:g.23275392AT[31], NC_000007.14:g.23275392AT[32], NC_000007.14:g.23275392AT[33], NC_000007.14:g.23275392AT[34], NC_000007.14:g.23275392AT[35], NC_000007.13:g.23315011AT[4], NC_000007.13:g.23315011AT[5], NC_000007.13:g.23315011AT[6], NC_000007.13:g.23315011AT[7], NC_000007.13:g.23315011AT[8], NC_000007.13:g.23315011AT[9], NC_000007.13:g.23315011AT[10], NC_000007.13:g.23315011AT[11], NC_000007.13:g.23315011AT[12], NC_000007.13:g.23315011AT[13], NC_000007.13:g.23315011AT[14], NC_000007.13:g.23315011AT[15], NC_000007.13:g.23315011AT[16], NC_000007.13:g.23315011AT[17], NC_000007.13:g.23315011AT[18], NC_000007.13:g.23315011AT[19], NC_000007.13:g.23315011AT[20], NC_000007.13:g.23315011AT[21], NC_000007.13:g.23315011AT[22], NC_000007.13:g.23315011AT[23], NC_000007.13:g.23315011AT[24], NC_000007.13:g.23315011AT[25], NC_000007.13:g.23315011AT[27], NC_000007.13:g.23315011AT[28], NC_000007.13:g.23315011AT[29], NC_000007.13:g.23315011AT[30], NC_000007.13:g.23315011AT[31], NC_000007.13:g.23315011AT[32], NC_000007.13:g.23315011AT[33], NC_000007.13:g.23315011AT[34], NC_000007.13:g.23315011AT[35]
      3.

      rs1491086224 [Homo sapiens]
        Variant type:
        DEL
        Alleles:
        TG>- [Show Flanks]
        Chromosome:
        7:23262636 (GRCh38)
        7:23302255 (GRCh37)
        Canonical SPDI:
        NC_000007.14:23262635:TG:
        Gene:
        GPNMB (Varview)
        Functional Consequence:
        intron_variant
        Validated:
        by frequency,by alfa,by cluster
        MAF:
        -=0.00177/21 (ALFA)
        -=0.000162/17 (GnomAD)
        -=0.00108/18 (TOMMO)
        HGVS:
        4.

        rs1491076330 has merged into rs11454349 [Homo sapiens]
          Variant type:
          DELINS
          Alleles:
          AA>-,A,AAA,AAAA,AAAAA [Show Flanks]
          Chromosome:
          7:23250579 (GRCh38)
          7:23290198 (GRCh37)
          Canonical SPDI:
          NC_000007.14:23250567:AAAAAAAAAAAAA:AAAAAAAAAAA,NC_000007.14:23250567:AAAAAAAAAAAAA:AAAAAAAAAAAA,NC_000007.14:23250567:AAAAAAAAAAAAA:AAAAAAAAAAAAAA,NC_000007.14:23250567:AAAAAAAAAAAAA:AAAAAAAAAAAAAAA,NC_000007.14:23250567:AAAAAAAAAAAAA:AAAAAAAAAAAAAAAA
          Gene:
          GPNMB (Varview)
          Functional Consequence:
          intron_variant
          Validated:
          by frequency,by alfa,by cluster
          MAF:
          AAAAAAAAAAAAAAA=0./0 (ALFA)
          -=0.0789/263 (1000Genomes)
          A=0.2782/163 (NorthernSweden)
          A=0.475/19 (GENOME_DK)
          HGVS:
          5.

          rs1491073623 [Homo sapiens]
            Variant type:
            DELINS
            Alleles:
            ->CTTTCTTTC [Show Flanks]
            Chromosome:
            7:23244243 (GRCh38)
            7:23283863 (GRCh37)
            Canonical SPDI:
            NC_000007.14:23244243:CTTTCTTTC:CTTTCTTTCCTTTCTTTC
            Validated:
            by frequency,by alfa,by cluster
            MAF:
            CTTTCTTTCCTTTCTTTC=0./0 (ALFA)
            CTTTCTTTC=0.000004/1 (TOPMED)
            HGVS:
            6.

            rs1490988733 [Homo sapiens]
              Variant type:
              SNV
              Alleles:
              A>G [Show Flanks]
              Chromosome:
              7:23270575 (GRCh38)
              7:23310194 (GRCh37)
              Canonical SPDI:
              NC_000007.14:23270574:A:G
              Gene:
              GPNMB (Varview)
              Functional Consequence:
              intron_variant
              Validated:
              by frequency,by alfa,by cluster
              MAF:
              G=0./0 (ALFA)
              G=0.000004/1 (TOPMED)
              G=0.000007/1 (GnomAD)
              HGVS:
              7.

              rs1490982752 [Homo sapiens]
                Variant type:
                SNV
                Alleles:
                A>G [Show Flanks]
                Chromosome:
                7:23271634 (GRCh38)
                7:23311253 (GRCh37)
                Canonical SPDI:
                NC_000007.14:23271633:A:G
                Gene:
                GPNMB (Varview)
                Functional Consequence:
                intron_variant
                Validated:
                by frequency,by alfa,by cluster
                MAF:
                G=0./0 (ALFA)
                G=0.000008/2 (TOPMED)
                G=0.000014/2 (GnomAD)
                HGVS:
                8.

                rs1490929100 [Homo sapiens]
                  Variant type:
                  SNV
                  Alleles:
                  C>T [Show Flanks]
                  Chromosome:
                  7:23256060 (GRCh38)
                  7:23295679 (GRCh37)
                  Canonical SPDI:
                  NC_000007.14:23256059:C:T
                  Gene:
                  GPNMB (Varview)
                  Functional Consequence:
                  intron_variant
                  Validated:
                  by frequency,by alfa,by cluster
                  MAF:
                  T=0./0 (ALFA)
                  T=0.000004/1 (TOPMED)
                  HGVS:
                  9.

                  rs1490920849 [Homo sapiens]
                    Variant type:
                    SNV
                    Alleles:
                    G>C [Show Flanks]
                    Chromosome:
                    7:23257748 (GRCh38)
                    7:23297367 (GRCh37)
                    Canonical SPDI:
                    NC_000007.14:23257747:G:C
                    Gene:
                    GPNMB (Varview)
                    Functional Consequence:
                    intron_variant
                    Validated:
                    by frequency
                    MAF:
                    C=0.000007/1 (GnomAD)
                    HGVS:
                    10.

                    rs1490820710 [Homo sapiens]
                      Variant type:
                      DELINS
                      Alleles:
                      ->GT [Show Flanks]
                      Chromosome:
                      7:23275412 (GRCh38)
                      7:23315032 (GRCh37)
                      Canonical SPDI:
                      NC_000007.14:23275412:T:TGT
                      Gene:
                      GPNMB (Varview)
                      Functional Consequence:
                      downstream_transcript_variant,500B_downstream_variant
                      Validated:
                      by frequency,by cluster
                      MAF:
                      TG=0.00012/2 (TOMMO)
                      TG=0.0006/44 (GnomAD)
                      HGVS:
                      11.

                      rs1490707904 [Homo sapiens]
                        Variant type:
                        SNV
                        Alleles:
                        G>C [Show Flanks]
                        Chromosome:
                        7:23263207 (GRCh38)
                        7:23302826 (GRCh37)
                        Canonical SPDI:
                        NC_000007.14:23263206:G:C
                        Gene:
                        GPNMB (Varview)
                        Functional Consequence:
                        intron_variant
                        Validated:
                        by frequency,by alfa,by cluster
                        MAF:
                        C=0./0 (ALFA)
                        C=0.000008/2 (TOPMED)
                        C=0.000014/2 (GnomAD)
                        HGVS:
                        13.

                        rs1490496622 [Homo sapiens]
                          Variant type:
                          SNV
                          Alleles:
                          G>T [Show Flanks]
                          Chromosome:
                          7:23271063 (GRCh38)
                          7:23310682 (GRCh37)
                          Canonical SPDI:
                          NC_000007.14:23271062:G:T
                          Gene:
                          GPNMB (Varview)
                          Functional Consequence:
                          intron_variant
                          Validated:
                          by frequency,by alfa,by cluster
                          MAF:
                          T=0./0 (ALFA)
                          T=0.000007/1 (GnomAD)
                          T=0.000008/2 (TOPMED)
                          HGVS:
                          14.

                          rs1490437359 [Homo sapiens]
                            Variant type:
                            SNV
                            Alleles:
                            A>G [Show Flanks]
                            Chromosome:
                            7:23256554 (GRCh38)
                            7:23296173 (GRCh37)
                            Canonical SPDI:
                            NC_000007.14:23256553:A:G
                            Gene:
                            GPNMB (Varview)
                            Functional Consequence:
                            intron_variant
                            Validated:
                            by frequency,by alfa,by cluster
                            MAF:
                            G=0./0 (ALFA)
                            G=0.000004/1 (TOPMED)
                            G=0.000007/1 (GnomAD)
                            HGVS:
                            15.

                            rs1490266819 [Homo sapiens]
                              Variant type:
                              SNV
                              Alleles:
                              C>A [Show Flanks]
                              Chromosome:
                              7:23260434 (GRCh38)
                              7:23300053 (GRCh37)
                              Canonical SPDI:
                              NC_000007.14:23260433:C:A
                              Gene:
                              GPNMB (Varview)
                              Functional Consequence:
                              intron_variant
                              Validated:
                              by frequency
                              MAF:
                              A=0.000004/1 (GnomAD_exomes)
                              HGVS:
                              16.

                              rs1490199480 [Homo sapiens]
                                Variant type:
                                SNV
                                Alleles:
                                G>C [Show Flanks]
                                Chromosome:
                                7:23253356 (GRCh38)
                                7:23292975 (GRCh37)
                                Canonical SPDI:
                                NC_000007.14:23253355:G:C
                                Gene:
                                GPNMB (Varview)
                                Functional Consequence:
                                missense_variant,coding_sequence_variant
                                Validated:
                                by frequency,by alfa,by cluster
                                MAF:
                                C=0./0 (ALFA)
                                C=0.000004/1 (TOPMED)
                                C=0.000007/1 (GnomAD)
                                HGVS:
                                17.

                                rs1490088173 [Homo sapiens]
                                  Variant type:
                                  SNV
                                  Alleles:
                                  T>A [Show Flanks]
                                  Chromosome:
                                  7:23245260 (GRCh38)
                                  7:23284879 (GRCh37)
                                  Canonical SPDI:
                                  NC_000007.14:23245259:T:A
                                  Gene:
                                  GPNMB (Varview)
                                  Functional Consequence:
                                  upstream_transcript_variant,2KB_upstream_variant
                                  Validated:
                                  by frequency,by alfa,by cluster
                                  MAF:
                                  A=0./0 (ALFA)
                                  A=0.02776/81 (KOREAN)
                                  HGVS:
                                  18.

                                  rs1490010801 [Homo sapiens]
                                    Variant type:
                                    SNV
                                    Alleles:
                                    C>T [Show Flanks]
                                    Chromosome:
                                    7:23247352 (GRCh38)
                                    7:23286971 (GRCh37)
                                    Canonical SPDI:
                                    NC_000007.14:23247351:C:T
                                    Gene:
                                    GPNMB (Varview)
                                    Functional Consequence:
                                    intron_variant
                                    Validated:
                                    by frequency,by alfa,by cluster
                                    MAF:
                                    T=0.000071/1 (ALFA)
                                    T=0.000004/1 (TOPMED)
                                    HGVS:
                                    19.

                                    rs1489995703 [Homo sapiens]
                                      Variant type:
                                      SNV
                                      Alleles:
                                      G>A [Show Flanks]
                                      Chromosome:
                                      7:23246185 (GRCh38)
                                      7:23285804 (GRCh37)
                                      Canonical SPDI:
                                      NC_000007.14:23246184:G:A
                                      Gene:
                                      GPNMB (Varview)
                                      Functional Consequence:
                                      upstream_transcript_variant,2KB_upstream_variant
                                      Validated:
                                      by frequency,by alfa,by cluster
                                      MAF:
                                      A=0./0 (ALFA)
                                      A=0.000004/1 (TOPMED)
                                      HGVS:
                                      20.

                                      rs1489902640 has merged into rs750640697 [Homo sapiens]
                                        Variant type:
                                        DELINS
                                        Alleles:
                                        AAAAAAAAA>-,AAAA,AAAAA,AAAAAA,AAAAAAA,AAAAAAAA,AAAAAAAAAA,AAAAAAAAAAA,AAAAAAAAAAAA [Show Flanks]
                                        Chromosome:
                                        7:23263623 (GRCh38)
                                        7:23303242 (GRCh37)
                                        Canonical SPDI:
                                        NC_000007.14:23263612:AAAAAAAAAAAAAAAAAAA:AAAAAAAAAA,NC_000007.14:23263612:AAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAA,NC_000007.14:23263612:AAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAA,NC_000007.14:23263612:AAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAA,NC_000007.14:23263612:AAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAA,NC_000007.14:23263612:AAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAA,NC_000007.14:23263612:AAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAA,NC_000007.14:23263612:AAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAA,NC_000007.14:23263612:AAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAA
                                        Gene:
                                        GPNMB (Varview)
                                        Functional Consequence:
                                        intron_variant
                                        Validated:
                                        by frequency,by alfa,by cluster
                                        MAF:
                                        AAAAAAAAAAAAAAAAA=0./0 (ALFA)
                                        -=0.0214/12 (NorthernSweden)
                                        -=0.325/13 (GENOME_DK)
                                        HGVS:

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center