Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 25035

1.

rs1491538217 has merged into rs34270543 [Homo sapiens]
    Variant type:
    DELINS
    Alleles:
    AAAAAAAAAAAAAAAA>-,A,AAA,AAAA,AAAAAA,AAAAAAAAA,AAAAAAAAAA,AAAAAAAAAAA,AAAAAAAAAAAA,AAAAAAAAAAAAA,AAAAAAAAAAAAAA,AAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA [Show Flanks]
    Chromosome:
    4:165377821 (GRCh38)
    4:166298973 (GRCh37)
    Canonical SPDI:
    NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165377813:AAAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
    Gene:
    CPE (Varview)
    Functional Consequence:
    2KB_upstream_variant,upstream_transcript_variant
    Validated:
    by frequency,by alfa,by cluster
    MAF:
    AAAAAAA=0./0 (ALFA)
    -=0.000026/7 (TOPMED)
    HGVS:
    NC_000004.12:g.165377821_165377836del, NC_000004.12:g.165377822_165377836del, NC_000004.12:g.165377824_165377836del, NC_000004.12:g.165377825_165377836del, NC_000004.12:g.165377827_165377836del, NC_000004.12:g.165377830_165377836del, NC_000004.12:g.165377831_165377836del, NC_000004.12:g.165377832_165377836del, NC_000004.12:g.165377833_165377836del, NC_000004.12:g.165377834_165377836del, NC_000004.12:g.165377835_165377836del, NC_000004.12:g.165377836del, NC_000004.12:g.165377836dup, NC_000004.12:g.165377835_165377836dup, NC_000004.12:g.165377834_165377836dup, NC_000004.12:g.165377833_165377836dup, NC_000004.12:g.165377832_165377836dup, NC_000004.12:g.165377831_165377836dup, NC_000004.12:g.165377830_165377836dup, NC_000004.12:g.165377829_165377836dup, NC_000004.12:g.165377828_165377836dup, NC_000004.12:g.165377827_165377836dup, NC_000004.12:g.165377826_165377836dup, NC_000004.12:g.165377825_165377836dup, NC_000004.12:g.165377824_165377836dup, NC_000004.12:g.165377823_165377836dup, NC_000004.12:g.165377822_165377836dup, NC_000004.11:g.166298973_166298988del, NC_000004.11:g.166298974_166298988del, NC_000004.11:g.166298976_166298988del, NC_000004.11:g.166298977_166298988del, NC_000004.11:g.166298979_166298988del, NC_000004.11:g.166298982_166298988del, NC_000004.11:g.166298983_166298988del, NC_000004.11:g.166298984_166298988del, NC_000004.11:g.166298985_166298988del, NC_000004.11:g.166298986_166298988del, NC_000004.11:g.166298987_166298988del, NC_000004.11:g.166298988del, NC_000004.11:g.166298988dup, NC_000004.11:g.166298987_166298988dup, NC_000004.11:g.166298986_166298988dup, NC_000004.11:g.166298985_166298988dup, NC_000004.11:g.166298984_166298988dup, NC_000004.11:g.166298983_166298988dup, NC_000004.11:g.166298982_166298988dup, NC_000004.11:g.166298981_166298988dup, NC_000004.11:g.166298980_166298988dup, NC_000004.11:g.166298979_166298988dup, NC_000004.11:g.166298978_166298988dup, NC_000004.11:g.166298977_166298988dup, NC_000004.11:g.166298976_166298988dup, NC_000004.11:g.166298975_166298988dup, NC_000004.11:g.166298974_166298988dup
    2.

    rs1491533014 [Homo sapiens]
      Variant type:
      DEL
      Alleles:
      CA>- [Show Flanks]
      Chromosome:
      4:165377813 (GRCh38)
      4:166298965 (GRCh37)
      Canonical SPDI:
      NC_000004.12:165377812:CA:
      Gene:
      CPE (Varview)
      Functional Consequence:
      upstream_transcript_variant,2KB_upstream_variant
      Validated:
      by frequency,by alfa
      MAF:
      -=0.00582/69 (ALFA)
      HGVS:
      3.

      rs1491532660 has merged into rs33941193 [Homo sapiens]
        Variant type:
        DELINS
        Alleles:
        TT>-,T,TTT,TTTT,TTTTTTTTTTTTTT [Show Flanks]
        Chromosome:
        4:165453986 (GRCh38)
        4:166375138 (GRCh37)
        Canonical SPDI:
        NC_000004.12:165453976:TTTTTTTTTTT:TTTTTTTTT,NC_000004.12:165453976:TTTTTTTTTTT:TTTTTTTTTT,NC_000004.12:165453976:TTTTTTTTTTT:TTTTTTTTTTTT,NC_000004.12:165453976:TTTTTTTTTTT:TTTTTTTTTTTTT,NC_000004.12:165453976:TTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTTT
        Gene:
        CPE (Varview)
        Functional Consequence:
        intron_variant
        Validated:
        by frequency,by alfa,by cluster
        MAF:
        TTTTTTTTTTTTT=0./0 (ALFA)
        -=0.4098/1460 (1000Genomes)
        HGVS:
        4.

        rs1491522159 has merged into rs71602593 [Homo sapiens]
          Variant type:
          DELINS
          Alleles:
          G>-,GG,GGG [Show Flanks]
          Chromosome:
          4:165486209 (GRCh38)
          4:166407361 (GRCh37)
          Canonical SPDI:
          NC_000004.12:165486208:GGGGGGG:GGGGGG,NC_000004.12:165486208:GGGGGGG:GGGGGGGG,NC_000004.12:165486208:GGGGGGG:GGGGGGGGG
          Gene:
          CPE (Varview)
          Functional Consequence:
          intron_variant
          Validated:
          by frequency,by alfa,by cluster
          MAF:
          GGGGGG=0.0319/318 (ALFA)
          -=0.155/639 (1000Genomes)
          HGVS:
          5.

          rs1491497160 has merged into rs10718543 [Homo sapiens]
            Variant type:
            DELINS
            Alleles:
            AAAAAAAAAAAAAA>-,A,AA,AAA,AAAA,AAAAAA,AAAAAAA,AAAAAAAA,AAAAAAAAA,AAAAAAAAAA,AAAAAAAAAAA,AAAAAAAAAAAA,AAAAAAAAAAAAA,AAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAAAA,AAAAAAAAAAAAAAAAAAAA [Show Flanks]
            Chromosome:
            4:165459923 (GRCh38)
            4:166381075 (GRCh37)
            Canonical SPDI:
            NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAA,NC_000004.12:165459914:AAAAAAAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAAAAAAAA
            Gene:
            CPE (Varview)
            Functional Consequence:
            intron_variant
            Validated:
            by frequency,by alfa,by cluster
            MAF:
            AAAAAAAA=0./0 (ALFA)
            HGVS:
            NC_000004.12:g.165459923_165459936del, NC_000004.12:g.165459924_165459936del, NC_000004.12:g.165459925_165459936del, NC_000004.12:g.165459926_165459936del, NC_000004.12:g.165459927_165459936del, NC_000004.12:g.165459929_165459936del, NC_000004.12:g.165459930_165459936del, NC_000004.12:g.165459931_165459936del, NC_000004.12:g.165459932_165459936del, NC_000004.12:g.165459933_165459936del, NC_000004.12:g.165459934_165459936del, NC_000004.12:g.165459935_165459936del, NC_000004.12:g.165459936del, NC_000004.12:g.165459936dup, NC_000004.12:g.165459935_165459936dup, NC_000004.12:g.165459934_165459936dup, NC_000004.12:g.165459932_165459936dup, NC_000004.12:g.165459931_165459936dup, NC_000004.11:g.166381075_166381088del, NC_000004.11:g.166381076_166381088del, NC_000004.11:g.166381077_166381088del, NC_000004.11:g.166381078_166381088del, NC_000004.11:g.166381079_166381088del, NC_000004.11:g.166381081_166381088del, NC_000004.11:g.166381082_166381088del, NC_000004.11:g.166381083_166381088del, NC_000004.11:g.166381084_166381088del, NC_000004.11:g.166381085_166381088del, NC_000004.11:g.166381086_166381088del, NC_000004.11:g.166381087_166381088del, NC_000004.11:g.166381088del, NC_000004.11:g.166381088dup, NC_000004.11:g.166381087_166381088dup, NC_000004.11:g.166381086_166381088dup, NC_000004.11:g.166381084_166381088dup, NC_000004.11:g.166381083_166381088dup
            6.

            rs1491462985 has merged into rs11421146 [Homo sapiens]
              Variant type:
              DELINS
              Alleles:
              TTTTTT>-,T,TT,TTT,TTTT,TTTTT,TTTTTTT,TTTTTTTT,TTTTTTTTT,TTTTTTTTTT,TTTTTTTTTTT,TTTTTTTTTTTTT,TTTTTTTTTTTTTT [Show Flanks]
              Chromosome:
              4:165481028 (GRCh38)
              4:166402180 (GRCh37)
              Canonical SPDI:
              NC_000004.12:165481016:TTTTTTTTTTTTTTTTT:TTTTTTTTTTT,NC_000004.12:165481016:TTTTTTTTTTTTTTTTT:TTTTTTTTTTTT,NC_000004.12:165481016:TTTTTTTTTTTTTTTTT:TTTTTTTTTTTTT,NC_000004.12:165481016:TTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTT,NC_000004.12:165481016:TTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTT,NC_000004.12:165481016:TTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTT,NC_000004.12:165481016:TTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTT,NC_000004.12:165481016:TTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTT,NC_000004.12:165481016:TTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTT,NC_000004.12:165481016:TTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTT,NC_000004.12:165481016:TTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTT,NC_000004.12:165481016:TTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTTTT,NC_000004.12:165481016:TTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTTTTT
              Gene:
              CPE (Varview)
              Functional Consequence:
              intron_variant
              Validated:
              by frequency,by alfa,by cluster
              MAF:
              TTTTTTTTTTTT=0./0 (ALFA)
              HGVS:
              NC_000004.12:g.165481028_165481033del, NC_000004.12:g.165481029_165481033del, NC_000004.12:g.165481030_165481033del, NC_000004.12:g.165481031_165481033del, NC_000004.12:g.165481032_165481033del, NC_000004.12:g.165481033del, NC_000004.12:g.165481033dup, NC_000004.12:g.165481032_165481033dup, NC_000004.12:g.165481031_165481033dup, NC_000004.12:g.165481030_165481033dup, NC_000004.12:g.165481029_165481033dup, NC_000004.12:g.165481027_165481033dup, NC_000004.12:g.165481026_165481033dup, NC_000004.11:g.166402180_166402185del, NC_000004.11:g.166402181_166402185del, NC_000004.11:g.166402182_166402185del, NC_000004.11:g.166402183_166402185del, NC_000004.11:g.166402184_166402185del, NC_000004.11:g.166402185del, NC_000004.11:g.166402185dup, NC_000004.11:g.166402184_166402185dup, NC_000004.11:g.166402183_166402185dup, NC_000004.11:g.166402182_166402185dup, NC_000004.11:g.166402181_166402185dup, NC_000004.11:g.166402179_166402185dup, NC_000004.11:g.166402178_166402185dup
              7.

              rs1491454464 [Homo sapiens]
                Variant type:
                INS
                Alleles:
                ->G [Show Flanks]
                Chromosome:
                4:165440455 (GRCh38)
                4:166361608 (GRCh37)
                Canonical SPDI:
                NC_000004.12:165440455::G
                Gene:
                CPE (Varview)
                Functional Consequence:
                intron_variant
                Validated:
                by frequency,by alfa,by cluster
                MAF:
                G=0.000084/1 (ALFA)
                G=0.000032/4 (GnomAD)
                HGVS:
                8.

                rs1491436290 [Homo sapiens]
                  Variant type:
                  DELINS
                  Alleles:
                  ->TTGTGTTTTTATTGTT [Show Flanks]
                  Chromosome:
                  4:165403696 (GRCh38)
                  4:166324849 (GRCh37)
                  Canonical SPDI:
                  NC_000004.12:165403696:GTTTTTATTGTT:GTTTTTATTGTTTTGTGTTTTTATTGTT
                  Gene:
                  CPE (Varview)
                  Functional Consequence:
                  intron_variant
                  Validated:
                  by frequency,by cluster
                  MAF:
                  GTTTTTATTGTTTTGT=0.000008/1 (GnomAD)
                  HGVS:
                  9.

                  rs1491432024 [Homo sapiens]
                    Variant type:
                    DELINS
                    Alleles:
                    ->GA,GATATATATATATATATATATATATAGA [Show Flanks]
                    Chromosome:
                    4:165480994 (GRCh38)
                    4:166402147 (GRCh37)
                    Canonical SPDI:
                    NC_000004.12:165480994:GA:GAGA,NC_000004.12:165480994:GA:GAGATATATATATATATATATATATATAGA
                    Gene:
                    CPE (Varview)
                    Functional Consequence:
                    intron_variant
                    Validated:
                    by frequency,by alfa,by cluster
                    MAF:
                    GAGA=0./0 (ALFA)
                    HGVS:
                    10.

                    rs1491426230 [Homo sapiens]
                      Variant type:
                      DELINS
                      Alleles:
                      ->T [Show Flanks]
                      Chromosome:
                      4:165457166 (GRCh38)
                      4:166378319 (GRCh37)
                      Canonical SPDI:
                      NC_000004.12:165457166:T:TT
                      Gene:
                      CPE (Varview)
                      Functional Consequence:
                      intron_variant
                      Validated:
                      by frequency,by alfa
                      MAF:
                      TT=0./0 (ALFA)
                      HGVS:
                      11.

                      rs1491334778 [Homo sapiens]
                        Variant type:
                        DEL
                        Alleles:
                        CA>- [Show Flanks]
                        Chromosome:
                        4:165459914 (GRCh38)
                        4:166381066 (GRCh37)
                        Canonical SPDI:
                        NC_000004.12:165459913:CA:
                        Gene:
                        CPE (Varview)
                        Functional Consequence:
                        intron_variant
                        Validated:
                        by frequency,by alfa,by cluster
                        MAF:
                        -=0.00051/6 (ALFA)
                        HGVS:
                        12.

                        rs1491231332 has merged into rs111764969 [Homo sapiens]
                          Variant type:
                          DELINS
                          Alleles:
                          AT>- [Show Flanks]
                          Chromosome:
                          4:165385422 (GRCh38)
                          4:166306574 (GRCh37)
                          Canonical SPDI:
                          NC_000004.12:165385420:TAT:T
                          Gene:
                          CPE (Varview), MIR578 (Varview)
                          Functional Consequence:
                          2KB_upstream_variant,upstream_transcript_variant,intron_variant
                          Validated:
                          by frequency,by alfa,by cluster
                          MAF:
                          T=0./0 (ALFA)
                          -=0.000008/1 (GnomAD)
                          HGVS:
                          13.

                          rs1491204860 has merged into rs11296419 [Homo sapiens]
                            Variant type:
                            DELINS
                            Alleles:
                            TT>-,T,TTT,TTTT [Show Flanks]
                            Chromosome:
                            4:165445297 (GRCh38)
                            4:166366449 (GRCh37)
                            Canonical SPDI:
                            NC_000004.12:165445288:TTTTTTTTTT:TTTTTTTT,NC_000004.12:165445288:TTTTTTTTTT:TTTTTTTTT,NC_000004.12:165445288:TTTTTTTTTT:TTTTTTTTTTT,NC_000004.12:165445288:TTTTTTTTTT:TTTTTTTTTTTT
                            Gene:
                            CPE (Varview)
                            Functional Consequence:
                            intron_variant
                            Validated:
                            by frequency,by alfa,by cluster
                            MAF:
                            TTTTTTTTTTTT=0.0001/1 (ALFA)
                            -=0.21514/992 (1000Genomes)
                            HGVS:
                            14.

                            rs1491201569 [Homo sapiens]
                              Variant type:
                              DEL
                              Alleles:
                              CG>- [Show Flanks]
                              Chromosome:
                              4:165436215 (GRCh38)
                              4:166357367 (GRCh37)
                              Canonical SPDI:
                              NC_000004.12:165436214:CG:
                              Gene:
                              CPE (Varview)
                              Functional Consequence:
                              intron_variant
                              Validated:
                              by frequency,by alfa,by cluster
                              MAF:
                              -=0.000184/3 (ALFA)
                              -=0.000117/16 (GnomAD)
                              -=0.001092/2 (Korea1K)
                              -=0.001492/25 (TOMMO)
                              HGVS:
                              15.

                              rs1491161430 [Homo sapiens]
                                Variant type:
                                DELINS
                                Alleles:
                                ->ATAGATATATATATATATATATATATT,ATATATATATATATATATATATATATT,ATATATATATATATATATATATATTTT,ATATATATATATATATATATATT,ATATATATATATATATATATATTTT,ATATATATATATATATATATT,ATATATATATATATATATATTTT,ATATATATATATATATATATTTTTT,ATATATATATATATATATATTTTTTT,ATATATATATATATATATT,ATATATATATATATATT,ATATATATATATATATTTT,ATATATATATATATT,ATATATATATATATTTT,ATATATATT,ATATATT,ATATT,ATT,ATTT,ATTTT [Show Flanks]
                                Chromosome:
                                4:165481016 (GRCh38)
                                4:166402169 (GRCh37)
                                Canonical SPDI:
                                NC_000004.12:165481016:T:TATAGATATATATATATATATATATATT,NC_000004.12:165481016:T:TATATATATATATATATATATATATATT,NC_000004.12:165481016:T:TATATATATATATATATATATATATTTT,NC_000004.12:165481016:T:TATATATATATATATATATATATT,NC_000004.12:165481016:T:TATATATATATATATATATATATTTT,NC_000004.12:165481016:T:TATATATATATATATATATATT,NC_000004.12:165481016:T:TATATATATATATATATATATTTT,NC_000004.12:165481016:T:TATATATATATATATATATATTTTTT,NC_000004.12:165481016:T:TATATATATATATATATATATTTTTTT,NC_000004.12:165481016:T:TATATATATATATATATATT,NC_000004.12:165481016:T:TATATATATATATATATT,NC_000004.12:165481016:T:TATATATATATATATATTTT,NC_000004.12:165481016:T:TATATATATATATATT,NC_000004.12:165481016:T:TATATATATATATATTTT,NC_000004.12:165481016:T:TATATATATT,NC_000004.12:165481016:T:TATATATT,NC_000004.12:165481016:T:TATATT,NC_000004.12:165481016:T:TATT,NC_000004.12:165481016:T:TATTT,NC_000004.12:165481016:T:TATTTT
                                Gene:
                                CPE (Varview)
                                Functional Consequence:
                                intron_variant
                                Validated:
                                by frequency,by alfa,by cluster
                                MAF:
                                TATATATATATATATATATT=0./0 (ALFA)
                                TAT=0.00241/39 (TOMMO)
                                HGVS:
                                NC_000004.12:g.165481017TA[2]GATATATATATATATATATATATT[1], NC_000004.12:g.165481017TA[13]TT[1], NC_000004.12:g.165481017TA[12]T[4], NC_000004.12:g.165481017TA[11]TT[1], NC_000004.12:g.165481017TA[11]T[4], NC_000004.12:g.165481017TA[10]TT[1], NC_000004.12:g.165481017TA[10]T[4], NC_000004.12:g.165481017TA[10]T[6], NC_000004.12:g.165481017TA[10]T[7], NC_000004.12:g.165481017TA[9]TT[1], NC_000004.12:g.165481017TA[8]TT[1], NC_000004.12:g.165481017TA[8]T[4], NC_000004.12:g.165481017TA[7]TT[1], NC_000004.12:g.165481017TA[7]T[4], NC_000004.12:g.165481017TA[4]TT[1], NC_000004.12:g.165481017TA[3]TT[1], NC_000004.12:g.165481017TA[2]TT[1], NC_000004.12:g.165481017_165481018insATT, NC_000004.12:g.165481017_165481018insATTT, NC_000004.12:g.165481017_165481018insATTTT, NC_000004.11:g.166402169TA[2]GATATATATATATATATATATATT[1], NC_000004.11:g.166402169TA[13]TT[1], NC_000004.11:g.166402169TA[12]T[4], NC_000004.11:g.166402169TA[11]TT[1], NC_000004.11:g.166402169TA[11]T[4], NC_000004.11:g.166402169TA[10]TT[1], NC_000004.11:g.166402169TA[10]T[4], NC_000004.11:g.166402169TA[10]T[6], NC_000004.11:g.166402169TA[10]T[7], NC_000004.11:g.166402169TA[9]TT[1], NC_000004.11:g.166402169TA[8]TT[1], NC_000004.11:g.166402169TA[8]T[4], NC_000004.11:g.166402169TA[7]TT[1], NC_000004.11:g.166402169TA[7]T[4], NC_000004.11:g.166402169TA[4]TT[1], NC_000004.11:g.166402169TA[3]TT[1], NC_000004.11:g.166402169TA[2]TT[1], NC_000004.11:g.166402169_166402170insATT, NC_000004.11:g.166402169_166402170insATTT, NC_000004.11:g.166402169_166402170insATTTT
                                16.

                                rs1491159327 [Homo sapiens]
                                  Variant type:
                                  SNV:
                                  Alleles:
                                  GG>-
                                  Chromosome:
                                  no mapping
                                  Canonical SPDI:
                                  17.

                                  rs1491134128 [Homo sapiens]
                                    Variant type:
                                    DEL
                                    Alleles:
                                    GG>- [Show Flanks]
                                    Chromosome:
                                    4:165480994 (GRCh38)
                                    4:166402146 (GRCh37)
                                    Canonical SPDI:
                                    NC_000004.12:165480993:GG:
                                    Gene:
                                    CPE (Varview)
                                    Functional Consequence:
                                    intron_variant
                                    Validated:
                                    by frequency,by alfa
                                    MAF:
                                    -=0./0 (ALFA)
                                    HGVS:
                                    18.

                                    rs1491123201 has merged into rs202083082 [Homo sapiens]
                                      Variant type:
                                      DELINS
                                      Alleles:
                                      ATTTT>- [Show Flanks]
                                      Chromosome:
                                      4:165444956 (GRCh38)
                                      4:166366108 (GRCh37)
                                      Canonical SPDI:
                                      NC_000004.12:165444948:TTATTTTATTTT:TTATTTT
                                      Gene:
                                      CPE (Varview)
                                      Functional Consequence:
                                      intron_variant
                                      Validated:
                                      by frequency,by alfa,by cluster
                                      MAF:
                                      TTATTTT=0.350966/5520 (ALFA)
                                      -=0.299809/41860 (GnomAD)
                                      -=0.344332/5771 (TOMMO)
                                      -=0.351842/1356 (ALSPAC)
                                      -=0.361111/1339 (TWINSUK)
                                      -=0.37/222 (NorthernSweden)
                                      -=0.390284/715 (Korea1K)
                                      HGVS:
                                      19.

                                      rs1491114605 [Homo sapiens]
                                        Variant type:
                                        DEL
                                        Alleles:
                                        AT>- [Show Flanks]
                                        Chromosome:
                                        4:165453976 (GRCh38)
                                        4:166375128 (GRCh37)
                                        Canonical SPDI:
                                        NC_000004.12:165453975:AT:
                                        Gene:
                                        CPE (Varview)
                                        Functional Consequence:
                                        intron_variant
                                        Validated:
                                        by frequency,by alfa,by cluster
                                        MAF:
                                        -=0./0 (ALFA)
                                        -=0.000008/2 (TOPMED)
                                        HGVS:
                                        20.

                                        rs1491109994 has merged into rs796196236 [Homo sapiens]
                                          Variant type:
                                          DELINS
                                          Alleles:
                                          CC>-,C,CCC,CCCC [Show Flanks]
                                          Chromosome:
                                          4:165440462 (GRCh38)
                                          4:166361614 (GRCh37)
                                          Canonical SPDI:
                                          NC_000004.12:165440454:CCCCCCCCC:CCCCCCC,NC_000004.12:165440454:CCCCCCCCC:CCCCCCCC,NC_000004.12:165440454:CCCCCCCCC:CCCCCCCCCC,NC_000004.12:165440454:CCCCCCCCC:CCCCCCCCCCC
                                          Gene:
                                          CPE (Varview)
                                          Functional Consequence:
                                          intron_variant
                                          Validated:
                                          by frequency,by alfa,by cluster
                                          MAF:
                                          CCCCCCCC=0./0 (ALFA)
                                          -=0.000219/58 (TOPMED)
                                          C=0.002222/4 (Korea1K)
                                          HGVS:

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center