Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 2647

1.

rs1490419612 [Homo sapiens]
    Variant type:
    SNV
    Alleles:
    A>G [Show Flanks]
    Chromosome:
    12:52809720 (GRCh38)
    12:53203504 (GRCh37)
    Canonical SPDI:
    NC_000012.12:52809719:A:G
    Gene:
    KRT4 (Varview)
    Functional Consequence:
    intron_variant
    Validated:
    by frequency,by alfa,by cluster
    MAF:
    G=0./0 (ALFA)
    G=0.000008/2 (TOPMED)
    HGVS:
    2.

    rs1490353058 [Homo sapiens]
      Variant type:
      SNV
      Alleles:
      G>A [Show Flanks]
      Chromosome:
      12:52808700 (GRCh38)
      12:53202484 (GRCh37)
      Canonical SPDI:
      NC_000012.12:52808699:G:A
      Gene:
      KRT4 (Varview)
      Functional Consequence:
      synonymous_variant,coding_sequence_variant
      Validated:
      by frequency,by alfa,by cluster
      MAF:
      A=0./0 (ALFA)
      A=0.000007/1 (GnomAD)
      A=0.000008/2 (TOPMED)
      HGVS:
      3.

      rs1490233349 [Homo sapiens]
        Variant type:
        SNV
        Alleles:
        A>G [Show Flanks]
        Chromosome:
        12:52809775 (GRCh38)
        12:53203559 (GRCh37)
        Canonical SPDI:
        NC_000012.12:52809774:A:G
        Gene:
        KRT4 (Varview)
        Functional Consequence:
        intron_variant
        Validated:
        by frequency,by alfa
        MAF:
        G=0./0 (ALFA)
        G=0.000007/1 (GnomAD)
        HGVS:
        4.

        rs1490101082 [Homo sapiens]
          Variant type:
          SNV
          Alleles:
          G>T [Show Flanks]
          Chromosome:
          12:52807890 (GRCh38)
          12:53201674 (GRCh37)
          Canonical SPDI:
          NC_000012.12:52807889:G:T
          Gene:
          KRT4 (Varview)
          Functional Consequence:
          intron_variant
          Validated:
          by frequency,by alfa,by cluster
          MAF:
          T=0.000071/1 (ALFA)
          T=0.000004/1 (TOPMED)
          T=0.000007/1 (GnomAD)
          HGVS:
          5.

          rs1489936455 [Homo sapiens]
            Variant type:
            DELINS
            Alleles:
            AAG>- [Show Flanks]
            Chromosome:
            12:52811772 (GRCh38)
            12:53205556 (GRCh37)
            Canonical SPDI:
            NC_000012.12:52811770:GAAG:G
            Gene:
            KRT4 (Varview)
            Functional Consequence:
            coding_sequence_variant,inframe_deletion
            Validated:
            by frequency,by alfa,by cluster
            MAF:
            G=0.000084/1 (ALFA)
            -=0.000007/1 (GnomAD)
            HGVS:
            6.

            rs1489928220 [Homo sapiens]
              Variant type:
              SNV
              Alleles:
              G>A [Show Flanks]
              Chromosome:
              12:52809286 (GRCh38)
              12:53203070 (GRCh37)
              Canonical SPDI:
              NC_000012.12:52809285:G:A
              Gene:
              KRT4 (Varview)
              Functional Consequence:
              intron_variant
              Validated:
              by frequency,by alfa,by cluster
              MAF:
              A=0./0 (ALFA)
              A=0.000004/1 (TOPMED)
              HGVS:
              7.

              rs1489897581 [Homo sapiens]
                Variant type:
                SNV
                Alleles:
                C>T [Show Flanks]
                Chromosome:
                12:52808320 (GRCh38)
                12:53202104 (GRCh37)
                Canonical SPDI:
                NC_000012.12:52808319:C:T
                Gene:
                KRT4 (Varview)
                Functional Consequence:
                coding_sequence_variant,missense_variant
                Validated:
                by frequency,by alfa,by cluster
                MAF:
                T=0./0 (ALFA)
                T=0.000004/1 (TOPMED)
                HGVS:
                8.

                rs1489861944 [Homo sapiens]
                  Variant type:
                  SNV
                  Alleles:
                  G>A [Show Flanks]
                  Chromosome:
                  12:52808213 (GRCh38)
                  12:53201997 (GRCh37)
                  Canonical SPDI:
                  NC_000012.12:52808212:G:A
                  Gene:
                  KRT4 (Varview)
                  Functional Consequence:
                  intron_variant
                  Validated:
                  by frequency,by alfa
                  MAF:
                  A=0./0 (ALFA)
                  HGVS:
                  9.

                  rs1489768033 [Homo sapiens]
                    Variant type:
                    SNV
                    Alleles:
                    C>A,G [Show Flanks]
                    Chromosome:
                    12:52812071 (GRCh38)
                    12:53205855 (GRCh37)
                    Canonical SPDI:
                    NC_000012.12:52812070:C:A,NC_000012.12:52812070:C:G
                    Gene:
                    KRT4 (Varview)
                    Functional Consequence:
                    intron_variant
                    Validated:
                    by frequency,by alfa,by cluster
                    MAF:
                    G=0./0 (ALFA)
                    A=0.000021/3 (GnomAD)
                    HGVS:
                    10.

                    rs1489687337 [Homo sapiens]
                      Variant type:
                      SNV
                      Alleles:
                      C>T [Show Flanks]
                      Chromosome:
                      12:52807745 (GRCh38)
                      12:53201529 (GRCh37)
                      Canonical SPDI:
                      NC_000012.12:52807744:C:T
                      Gene:
                      KRT4 (Varview)
                      Functional Consequence:
                      synonymous_variant,coding_sequence_variant
                      Validated:
                      by frequency
                      MAF:
                      T=0.000004/1 (GnomAD_exomes)
                      HGVS:
                      11.

                      rs1489594916 [Homo sapiens]
                        Variant type:
                        SNV
                        Alleles:
                        A>C [Show Flanks]
                        Chromosome:
                        12:52815750 (GRCh38)
                        12:53209534 (GRCh37)
                        Canonical SPDI:
                        NC_000012.12:52815749:A:C
                        Gene:
                        KRT4 (Varview)
                        Functional Consequence:
                        upstream_transcript_variant,2KB_upstream_variant
                        Validated:
                        by frequency,by alfa,by cluster
                        MAF:
                        C=0.000071/1 (ALFA)
                        C=0.000019/5 (TOPMED)
                        C=0.000029/4 (GnomAD)
                        HGVS:
                        12.

                        rs1488691212 [Homo sapiens]
                          Variant type:
                          SNV
                          Alleles:
                          T>C [Show Flanks]
                          Chromosome:
                          12:52806366 (GRCh38)
                          12:53200150 (GRCh37)
                          Canonical SPDI:
                          NC_000012.12:52806365:T:C
                          Gene:
                          KRT3 (Varview), KRT4 (Varview)
                          Functional Consequence:
                          500B_downstream_variant,upstream_transcript_variant,downstream_transcript_variant,2KB_upstream_variant
                          Validated:
                          by frequency
                          MAF:
                          C=0.000007/1 (GnomAD)
                          HGVS:
                          13.

                          rs1488487576 [Homo sapiens]
                            Variant type:
                            SNV
                            Alleles:
                            T>A,C [Show Flanks]
                            Chromosome:
                            12:52814218 (GRCh38)
                            12:53208002 (GRCh37)
                            Canonical SPDI:
                            NC_000012.12:52814217:T:A,NC_000012.12:52814217:T:C
                            Gene:
                            KRT4 (Varview)
                            Functional Consequence:
                            upstream_transcript_variant,2KB_upstream_variant
                            Validated:
                            by frequency,by alfa,by cluster
                            MAF:
                            C=0./0 (ALFA)
                            C=0.000007/1 (GnomAD)
                            HGVS:
                            14.

                            rs1487886714 [Homo sapiens]
                              Variant type:
                              SNV
                              Alleles:
                              G>T [Show Flanks]
                              Chromosome:
                              12:52813223 (GRCh38)
                              12:53207007 (GRCh37)
                              Canonical SPDI:
                              NC_000012.12:52813222:G:T
                              Gene:
                              KRT4 (Varview)
                              Functional Consequence:
                              intron_variant
                              Validated:
                              by frequency,by cluster
                              MAF:
                              T=0.0022/4 (Korea1K)
                              HGVS:
                              15.

                              rs1487809611 [Homo sapiens]
                                Variant type:
                                SNV
                                Alleles:
                                T>A [Show Flanks]
                                Chromosome:
                                12:52811168 (GRCh38)
                                12:53204952 (GRCh37)
                                Canonical SPDI:
                                NC_000012.12:52811167:T:A
                                Gene:
                                KRT4 (Varview)
                                Functional Consequence:
                                intron_variant
                                Validated:
                                by frequency,by alfa,by cluster
                                MAF:
                                A=0./0 (ALFA)
                                A=0.000071/10 (GnomAD)
                                A=0.000106/28 (TOPMED)
                                HGVS:
                                16.

                                rs1487674496 [Homo sapiens]
                                  Variant type:
                                  SNV
                                  Alleles:
                                  G>A [Show Flanks]
                                  Chromosome:
                                  12:52808952 (GRCh38)
                                  12:53202736 (GRCh37)
                                  Canonical SPDI:
                                  NC_000012.12:52808951:G:A
                                  Gene:
                                  KRT4 (Varview)
                                  Functional Consequence:
                                  intron_variant
                                  Validated:
                                  by frequency,by alfa,by cluster
                                  MAF:
                                  A=0./0 (ALFA)
                                  A=0.000011/3 (TOPMED)
                                  A=0.000014/2 (GnomAD)
                                  HGVS:
                                  17.

                                  rs1487504496 [Homo sapiens]
                                    Variant type:
                                    SNV:
                                    Alleles:
                                    ->TAAGCACTGCACCTGTGTTGATA
                                    Chromosome:
                                    no mapping
                                    Canonical SPDI:
                                    18.

                                    rs1487030314 [Homo sapiens]
                                      Variant type:
                                      SNV
                                      Alleles:
                                      G>A [Show Flanks]
                                      Chromosome:
                                      12:52806944 (GRCh38)
                                      12:53200728 (GRCh37)
                                      Canonical SPDI:
                                      NC_000012.12:52806943:G:A
                                      Gene:
                                      KRT3 (Varview), KRT4 (Varview)
                                      Functional Consequence:
                                      upstream_transcript_variant,3_prime_UTR_variant,2KB_upstream_variant
                                      Validated:
                                      by frequency,by alfa,by cluster
                                      MAF:
                                      A=0./0 (ALFA)
                                      A=0.000007/1 (GnomAD)
                                      A=0.000008/2 (TOPMED)
                                      HGVS:
                                      19.

                                      rs1486488577 [Homo sapiens]
                                        Variant type:
                                        SNV
                                        Alleles:
                                        A>G [Show Flanks]
                                        Chromosome:
                                        12:52813929 (GRCh38)
                                        12:53207713 (GRCh37)
                                        Canonical SPDI:
                                        NC_000012.12:52813928:A:G
                                        Gene:
                                        KRT4 (Varview)
                                        Functional Consequence:
                                        coding_sequence_variant,missense_variant
                                        Validated:
                                        by frequency,by alfa,by cluster
                                        MAF:
                                        G=0.000054/1 (ALFA)
                                        G=0.000004/1 (GnomAD_exomes)
                                        G=0.000011/3 (TOPMED)
                                        G=0.000027/3 (GnomAD)
                                        G=0.000223/1 (Estonian)
                                        HGVS:
                                        20.

                                        rs1485026377 [Homo sapiens]
                                          Variant type:
                                          SNV
                                          Alleles:
                                          C>T [Show Flanks]
                                          Chromosome:
                                          12:52812834 (GRCh38)
                                          12:53206618 (GRCh37)
                                          Canonical SPDI:
                                          NC_000012.12:52812833:C:T
                                          Gene:
                                          KRT4 (Varview)
                                          Functional Consequence:
                                          intron_variant
                                          Validated:
                                          by frequency,by alfa,by cluster
                                          MAF:
                                          T=0./0 (ALFA)
                                          T=0.000004/1 (TOPMED)
                                          HGVS:

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center