Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 19616

1.

rs1491556557 [Homo sapiens]
    Variant type:
    DELINS
    Alleles:
    GA>- [Show Flanks]
    Chromosome:
    9:95510742 (GRCh38)
    9:98273024 (GRCh37)
    Canonical SPDI:
    NC_000009.12:95510740:AGA:A
    Gene:
    PTCH1 (Varview)
    Functional Consequence:
    intron_variant,upstream_transcript_variant,genic_upstream_transcript_variant
    Validated:
    by frequency,by alfa,by cluster
    MAF:
    A=0.000084/1 (ALFA)
    -=0.00008/11 (GnomAD)
    HGVS:
    2.

    rs1491509369 [Homo sapiens]
      Variant type:
      DELINS
      Alleles:
      ->TGACAC [Show Flanks]
      Chromosome:
      9:95490520 (GRCh38)
      9:98252803 (GRCh37)
      Canonical SPDI:
      NC_000009.12:95490520:AC:ACTGACAC
      Gene:
      PTCH1 (Varview)
      Functional Consequence:
      intron_variant
      Validated:
      by frequency,by alfa,by cluster
      MAF:
      ACTGACAC=0./0 (ALFA)
      ACTGAC=0.000004/1 (TOPMED)
      ACTGAC=0.000008/1 (GnomAD)
      HGVS:
      3.

      rs1491502780 has merged into rs962367211 [Homo sapiens]
        Variant type:
        DELINS
        Alleles:
        TGTGTG>-,TG,TGTG,TGTGTGTG,TGTGTGTGTG,TGTGTGTGTGTG,TGTGTGTGTGTGTG [Show Flanks]
        Chromosome:
        9:95508054 (GRCh38)
        9:98270336 (GRCh37)
        Canonical SPDI:
        NC_000009.12:95508042:GTGTGTGTGTGTGTGTG:GTGTGTGTGTG,NC_000009.12:95508042:GTGTGTGTGTGTGTGTG:GTGTGTGTGTGTG,NC_000009.12:95508042:GTGTGTGTGTGTGTGTG:GTGTGTGTGTGTGTG,NC_000009.12:95508042:GTGTGTGTGTGTGTGTG:GTGTGTGTGTGTGTGTGTG,NC_000009.12:95508042:GTGTGTGTGTGTGTGTG:GTGTGTGTGTGTGTGTGTGTG,NC_000009.12:95508042:GTGTGTGTGTGTGTGTG:GTGTGTGTGTGTGTGTGTGTGTG,NC_000009.12:95508042:GTGTGTGTGTGTGTGTG:GTGTGTGTGTGTGTGTGTGTGTGTG
        Gene:
        PTCH1 (Varview)
        Functional Consequence:
        upstream_transcript_variant,genic_upstream_transcript_variant,intron_variant
        Validated:
        by frequency,by alfa,by cluster
        MAF:
        GTGTGTGTGTGTG=0./0 (ALFA)
        -=0.00171/1 (NorthernSweden)
        HGVS:
        4.

        rs1491476722 has merged into rs796250728 [Homo sapiens]
          Variant type:
          DELINS
          Alleles:
          AG>- [Show Flanks]
          Chromosome:
          9:95472108 (GRCh38)
          9:98234390 (GRCh37)
          Canonical SPDI:
          NC_000009.12:95472105:AGAG:AG
          Gene:
          PTCH1 (Varview)
          Functional Consequence:
          genic_downstream_transcript_variant,intron_variant
          Validated:
          by frequency,by alfa,by cluster
          MAF:
          AGAG=0.045587/843 (ALFA)
          -=0.010248/38 (TWINSUK)
          -=0.011667/7 (NorthernSweden)
          -=0.014011/54 (ALSPAC)
          -=0.01583/70 (Estonian)
          -=0.025/1 (GENOME_DK)
          -=0.072762/10166 (GnomAD)
          -=0.07859/20802 (TOPMED)
          -=0.11/22 (Vietnamese)
          AG=0.112821/66 (1000Genomes)
          -=0.119212/1998 (TOMMO)
          -=0.121725/223 (Korea1K)
          HGVS:
          5.

          rs1491469834 [Homo sapiens]
            Variant type:
            DELINS
            Alleles:
            ->CCACACACACAC [Show Flanks]
            Chromosome:
            9:95452329 (GRCh38)
            9:98214612 (GRCh37)
            Canonical SPDI:
            NC_000009.12:95452329:CACACACACAC:CACACACACACCCACACACACAC
            Gene:
            PTCH1 (Varview)
            Functional Consequence:
            intron_variant,genic_downstream_transcript_variant
            Validated:
            by frequency,by alfa,by cluster
            MAF:
            CACACACACACCCACACACACAC=0./0 (ALFA)
            CACACACACACC=0.000004/1 (TOPMED)
            CACACACACACC=0.000035/1 (GnomAD)
            HGVS:
            6.

            rs1491457620 has merged into rs113161410 [Homo sapiens]
              Variant type:
              DELINS
              Alleles:
              ->A [Show Flanks]
              Chromosome:
              9:95472105 (GRCh38)
              9:98234388 (GRCh37)
              Canonical SPDI:
              NC_000009.12:95472105:A:AA
              Gene:
              PTCH1 (Varview)
              Functional Consequence:
              intron_variant,genic_downstream_transcript_variant
              Validated:
              by frequency,by alfa,by cluster
              MAF:
              AA=0.011977/221 (ALFA)
              A=0.006682/29 (Estonian)
              A=0.010869/2877 (TOPMED)
              A=0.010963/1532 (GnomAD)
              A=0.011667/7 (NorthernSweden)
              A=0.016087/62 (ALSPAC)
              A=0.016721/62 (TWINSUK)
              A=0.022136/371 (TOMMO)
              A=0.053191/10 (Vietnamese)
              HGVS:
              7.

              rs1491434927 [Homo sapiens]
                Variant type:
                DELINS
                Alleles:
                G>-,GGG [Show Flanks]
                Chromosome:
                9:95514621 (GRCh38)
                9:98276903 (GRCh37)
                Canonical SPDI:
                NC_000009.12:95514620:GG:G,NC_000009.12:95514620:GG:GGGG
                Gene:
                PTCH1 (Varview)
                Functional Consequence:
                intron_variant,genic_upstream_transcript_variant
                Validated:
                by frequency,by alfa
                MAF:
                GGGG=0.000066/1 (ALFA)
                GG=0.000178/21 (GnomAD)
                HGVS:
                8.

                rs1491424230 [Homo sapiens]
                  Variant type:
                  INS
                  Alleles:
                  ->A [Show Flanks]
                  Chromosome:
                  9:95473543 (GRCh38)
                  9:98235826 (GRCh37)
                  Canonical SPDI:
                  NC_000009.12:95473543::A
                  Gene:
                  PTCH1 (Varview)
                  Functional Consequence:
                  intron_variant,genic_downstream_transcript_variant
                  Validated:
                  by frequency,by alfa,by cluster
                  MAF:
                  A=0./0 (ALFA)
                  A=0.00002/1 (GnomAD)
                  HGVS:
                  9.

                  rs1491411215 has merged into rs139956254 [Homo sapiens]
                    Variant type:
                    DELINS
                    Alleles:
                    ACACACACACAC>-,AC,ACAC,ACACAC,ACACACAC,ACACACACAC,ACACACACACACAC,ACACACACACACACAC,ACACACACACACACACAC,ACACACACACACACACACAC [Show Flanks]
                    Chromosome:
                    9:95507908 (GRCh38)
                    9:98270190 (GRCh37)
                    Canonical SPDI:
                    NC_000009.12:95507905:ACACACACACACAC:AC,NC_000009.12:95507905:ACACACACACACAC:ACAC,NC_000009.12:95507905:ACACACACACACAC:ACACAC,NC_000009.12:95507905:ACACACACACACAC:ACACACAC,NC_000009.12:95507905:ACACACACACACAC:ACACACACAC,NC_000009.12:95507905:ACACACACACACAC:ACACACACACAC,NC_000009.12:95507905:ACACACACACACAC:ACACACACACACACAC,NC_000009.12:95507905:ACACACACACACAC:ACACACACACACACACAC,NC_000009.12:95507905:ACACACACACACAC:ACACACACACACACACACAC,NC_000009.12:95507905:ACACACACACACAC:ACACACACACACACACACACAC
                    Gene:
                    PTCH1 (Varview)
                    Functional Consequence:
                    intron_variant,upstream_transcript_variant,genic_upstream_transcript_variant
                    Validated:
                    by frequency,by alfa,by cluster
                    MAF:
                    AC=0./0 (ALFA)
                    ACAC=0.31669/1586 (1000Genomes)
                    HGVS:
                    NC_000009.12:g.95507906AC[1], NC_000009.12:g.95507906AC[2], NC_000009.12:g.95507906AC[3], NC_000009.12:g.95507906AC[4], NC_000009.12:g.95507906AC[5], NC_000009.12:g.95507906AC[6], NC_000009.12:g.95507906AC[8], NC_000009.12:g.95507906AC[9], NC_000009.12:g.95507906AC[10], NC_000009.12:g.95507906AC[11], NC_000009.11:g.98270188AC[1], NC_000009.11:g.98270188AC[2], NC_000009.11:g.98270188AC[3], NC_000009.11:g.98270188AC[4], NC_000009.11:g.98270188AC[5], NC_000009.11:g.98270188AC[6], NC_000009.11:g.98270188AC[8], NC_000009.11:g.98270188AC[9], NC_000009.11:g.98270188AC[10], NC_000009.11:g.98270188AC[11], NG_007664.1:g.14047GT[1], NG_007664.1:g.14047GT[2], NG_007664.1:g.14047GT[3], NG_007664.1:g.14047GT[4], NG_007664.1:g.14047GT[5], NG_007664.1:g.14047GT[6], NG_007664.1:g.14047GT[8], NG_007664.1:g.14047GT[9], NG_007664.1:g.14047GT[10], NG_007664.1:g.14047GT[11]
                    10.

                    rs1491364087 [Homo sapiens]
                      Variant type:
                      DEL
                      Alleles:
                      GA>- [Show Flanks]
                      Chromosome:
                      9:95490520 (GRCh38)
                      9:98252802 (GRCh37)
                      Canonical SPDI:
                      NC_000009.12:95490519:GA:
                      Gene:
                      PTCH1 (Varview)
                      Functional Consequence:
                      intron_variant
                      Validated:
                      by frequency,by alfa,by cluster
                      MAF:
                      -=0.000422/5 (ALFA)
                      -=0.000392/43 (GnomAD)
                      HGVS:
                      11.

                      rs1491293624 [Homo sapiens]
                        Variant type:
                        DELINS
                        Alleles:
                        AA>- [Show Flanks]
                        Chromosome:
                        9:95508111 (GRCh38)
                        9:98270393 (GRCh37)
                        Canonical SPDI:
                        NC_000009.12:95508109:AAA:A
                        Gene:
                        PTCH1 (Varview)
                        Functional Consequence:
                        intron_variant,upstream_transcript_variant,genic_upstream_transcript_variant
                        Validated:
                        by frequency,by alfa,by cluster
                        MAF:
                        A=0./0 (ALFA)
                        -=0.000011/3 (TOPMED)
                        HGVS:
                        13.

                        rs1491212749 has merged into rs1370214107 [Homo sapiens]
                          Variant type:
                          DELINS
                          Alleles:
                          GCACACACACACAC>-,GCACACACACACACGCACACACACACAC [Show Flanks]
                          Chromosome:
                          9:95507920 (GRCh38)
                          9:98270202 (GRCh37)
                          Canonical SPDI:
                          NC_000009.12:95507906:CACACACACACACGCACACACACACAC:CACACACACACAC,NC_000009.12:95507906:CACACACACACACGCACACACACACAC:CACACACACACACGCACACACACACACGCACACACACACAC
                          Gene:
                          PTCH1 (Varview)
                          Functional Consequence:
                          genic_upstream_transcript_variant,intron_variant,splice_donor_variant,upstream_transcript_variant
                          Validated:
                          by frequency,by alfa,by cluster
                          MAF:
                          CACACACACACACGCACACACACACACGCACACACACACAC=0./0 (ALFA)
                          -=0.00188/1 (NorthernSweden)
                          HGVS:
                          14.

                          rs1491118204 [Homo sapiens]
                            Variant type:
                            DELINS
                            Alleles:
                            ->T [Show Flanks]
                            Chromosome:
                            9:95511639 (GRCh38)
                            9:98273922 (GRCh37)
                            Canonical SPDI:
                            NC_000009.12:95511639:T:TT
                            Gene:
                            PTCH1 (Varview)
                            Functional Consequence:
                            intron_variant,genic_upstream_transcript_variant
                            Validated:
                            by frequency,by alfa,by cluster
                            MAF:
                            TT=0./0 (ALFA)
                            T=0.000004/1 (TOPMED)
                            T=0.000007/1 (GnomAD)
                            HGVS:
                            15.

                            rs1491107170 [Homo sapiens]
                              Variant type:
                              DEL
                              Alleles:
                              AG>- [Show Flanks]
                              Chromosome:
                              9:95514620 (GRCh38)
                              9:98276902 (GRCh37)
                              Canonical SPDI:
                              NC_000009.12:95514619:AG:
                              Gene:
                              PTCH1 (Varview)
                              Functional Consequence:
                              intron_variant,genic_upstream_transcript_variant
                              Validated:
                              by frequency
                              MAF:
                              -=0.000008/1 (GnomAD)
                              HGVS:
                              16.

                              rs1491102177 has merged into rs34481207 [Homo sapiens]
                                Variant type:
                                DELINS
                                Alleles:
                                TTTTTTTTTTT>-,TTT,TTTT,TTTTT,TTTTTT,TTTTTTT,TTTTTTTT,TTTTTTTTT,TTTTTTTTTT,TTTTTTTTTTTT,TTTTTTTTTTTTT,TTTTTTTTTTTTTT,TTTTTTTTTTTTTTT [Show Flanks]
                                Chromosome:
                                9:95473552 (GRCh38)
                                9:98235834 (GRCh37)
                                Canonical SPDI:
                                NC_000009.12:95473542:TTTTTTTTTTTTTTTTTTTT:TTTTTTTTT,NC_000009.12:95473542:TTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTT,NC_000009.12:95473542:TTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTT,NC_000009.12:95473542:TTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTT,NC_000009.12:95473542:TTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTT,NC_000009.12:95473542:TTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTT,NC_000009.12:95473542:TTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTT,NC_000009.12:95473542:TTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTT,NC_000009.12:95473542:TTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTT,NC_000009.12:95473542:TTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTT,NC_000009.12:95473542:TTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTT,NC_000009.12:95473542:TTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTTT,NC_000009.12:95473542:TTTTTTTTTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTTTT
                                Gene:
                                PTCH1 (Varview)
                                Functional Consequence:
                                intron_variant,genic_downstream_transcript_variant
                                Validated:
                                by frequency,by alfa,by cluster
                                MAF:
                                TTTTTTTTTTTTT=0./0 (ALFA)
                                -=0.3333/1669 (1000Genomes)
                                HGVS:
                                NC_000009.12:g.95473552_95473562del, NC_000009.12:g.95473555_95473562del, NC_000009.12:g.95473556_95473562del, NC_000009.12:g.95473557_95473562del, NC_000009.12:g.95473558_95473562del, NC_000009.12:g.95473559_95473562del, NC_000009.12:g.95473560_95473562del, NC_000009.12:g.95473561_95473562del, NC_000009.12:g.95473562del, NC_000009.12:g.95473562dup, NC_000009.12:g.95473561_95473562dup, NC_000009.12:g.95473560_95473562dup, NC_000009.12:g.95473559_95473562dup, NC_000009.11:g.98235834_98235844del, NC_000009.11:g.98235837_98235844del, NC_000009.11:g.98235838_98235844del, NC_000009.11:g.98235839_98235844del, NC_000009.11:g.98235840_98235844del, NC_000009.11:g.98235841_98235844del, NC_000009.11:g.98235842_98235844del, NC_000009.11:g.98235843_98235844del, NC_000009.11:g.98235844del, NC_000009.11:g.98235844dup, NC_000009.11:g.98235843_98235844dup, NC_000009.11:g.98235842_98235844dup, NC_000009.11:g.98235841_98235844dup, NG_007664.1:g.48413_48423del, NG_007664.1:g.48416_48423del, NG_007664.1:g.48417_48423del, NG_007664.1:g.48418_48423del, NG_007664.1:g.48419_48423del, NG_007664.1:g.48420_48423del, NG_007664.1:g.48421_48423del, NG_007664.1:g.48422_48423del, NG_007664.1:g.48423del, NG_007664.1:g.48423dup, NG_007664.1:g.48422_48423dup, NG_007664.1:g.48421_48423dup, NG_007664.1:g.48420_48423dup
                                17.

                                rs1491075053 has merged into rs3215875 [Homo sapiens]
                                  Variant type:
                                  DELINS
                                  Alleles:
                                  TTTTT>-,T,TTT,TTTT,TTTTTT,TTTTTTT,TTTTTTTTTTTTTTTTTTT [Show Flanks]
                                  Chromosome:
                                  9:95480916 (GRCh38)
                                  9:98243198 (GRCh37)
                                  Canonical SPDI:
                                  NC_000009.12:95480907:TTTTTTTTTTTTT:TTTTTTTT,NC_000009.12:95480907:TTTTTTTTTTTTT:TTTTTTTTT,NC_000009.12:95480907:TTTTTTTTTTTTT:TTTTTTTTTTT,NC_000009.12:95480907:TTTTTTTTTTTTT:TTTTTTTTTTTT,NC_000009.12:95480907:TTTTTTTTTTTTT:TTTTTTTTTTTTTT,NC_000009.12:95480907:TTTTTTTTTTTTT:TTTTTTTTTTTTTTT,NC_000009.12:95480907:TTTTTTTTTTTTT:TTTTTTTTTTTTTTTTTTTTTTTTTTT
                                  Gene:
                                  PTCH1 (Varview)
                                  Functional Consequence:
                                  genic_downstream_transcript_variant,intron_variant
                                  Validated:
                                  by frequency,by alfa,by cluster
                                  MAF:
                                  TTTTTTTTT=0./0 (ALFA)
                                  -=0.234/1012 (1000Genomes)
                                  HGVS:
                                  18.

                                  rs1491068988 has merged into rs35918689 [Homo sapiens]
                                    Variant type:
                                    DELINS
                                    Alleles:
                                    AAAA>-,A,AA,AAA,AAAAA,AAAAAA,AAAAAAA [Show Flanks]
                                    Chromosome:
                                    9:95501550 (GRCh38)
                                    9:98263832 (GRCh37)
                                    Canonical SPDI:
                                    NC_000009.12:95501539:AAAAAAAAAAAAAA:AAAAAAAAAA,NC_000009.12:95501539:AAAAAAAAAAAAAA:AAAAAAAAAAA,NC_000009.12:95501539:AAAAAAAAAAAAAA:AAAAAAAAAAAA,NC_000009.12:95501539:AAAAAAAAAAAAAA:AAAAAAAAAAAAA,NC_000009.12:95501539:AAAAAAAAAAAAAA:AAAAAAAAAAAAAAA,NC_000009.12:95501539:AAAAAAAAAAAAAA:AAAAAAAAAAAAAAAA,NC_000009.12:95501539:AAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAA
                                    Gene:
                                    PTCH1 (Varview)
                                    Functional Consequence:
                                    intron_variant
                                    Validated:
                                    by frequency,by alfa,by cluster
                                    MAF:
                                    AAAAAAAAAAA=0./0 (ALFA)
                                    -=0.053/193 (1000Genomes)
                                    A=0.3018/1119 (TWINSUK)
                                    A=0.308/1187 (ALSPAC)
                                    A=0.425/17 (GENOME_DK)
                                    HGVS:
                                    19.

                                    rs1491052758 has merged into rs59205702 [Homo sapiens]
                                      Variant type:
                                      DELINS
                                      Alleles:
                                      ACACACAC>-,AC,ACAC,ACACAC,ACACACACAC,ACACACACACAC,ACACACACACACAC,ACACACACACACACAC,ACACACACACACACACAC,ACACACACACACACACACACAC [Show Flanks]
                                      Chromosome:
                                      9:95444521 (GRCh38)
                                      9:98206803 (GRCh37)
                                      Canonical SPDI:
                                      NC_000009.12:95444509:CACACACACACACACACAC:CACACACACAC,NC_000009.12:95444509:CACACACACACACACACAC:CACACACACACAC,NC_000009.12:95444509:CACACACACACACACACAC:CACACACACACACAC,NC_000009.12:95444509:CACACACACACACACACAC:CACACACACACACACAC,NC_000009.12:95444509:CACACACACACACACACAC:CACACACACACACACACACAC,NC_000009.12:95444509:CACACACACACACACACAC:CACACACACACACACACACACAC,NC_000009.12:95444509:CACACACACACACACACAC:CACACACACACACACACACACACAC,NC_000009.12:95444509:CACACACACACACACACAC:CACACACACACACACACACACACACAC,NC_000009.12:95444509:CACACACACACACACACAC:CACACACACACACACACACACACACACAC,NC_000009.12:95444509:CACACACACACACACACAC:CACACACACACACACACACACACACACACACAC
                                      Gene:
                                      PTCH1 (Varview)
                                      Functional Consequence:
                                      non_coding_transcript_variant,3_prime_UTR_variant,genic_downstream_transcript_variant
                                      Clinical significance:
                                      likely-benign,uncertain-significance
                                      Validated:
                                      by frequency,by alfa,by cluster
                                      MAF:
                                      CACACACACACAC=0./0 (ALFA)
                                      CA=0.10833/65 (NorthernSweden)
                                      CA=0.13279/665 (1000Genomes)
                                      HGVS:
                                      NC_000009.12:g.95444511AC[5], NC_000009.12:g.95444511AC[6], NC_000009.12:g.95444511AC[7], NC_000009.12:g.95444511AC[8], NC_000009.12:g.95444511AC[10], NC_000009.12:g.95444511AC[11], NC_000009.12:g.95444511AC[12], NC_000009.12:g.95444511AC[13], NC_000009.12:g.95444511AC[14], NC_000009.12:g.95444511AC[16], NC_000009.11:g.98206793AC[5], NC_000009.11:g.98206793AC[6], NC_000009.11:g.98206793AC[7], NC_000009.11:g.98206793AC[8], NC_000009.11:g.98206793AC[10], NC_000009.11:g.98206793AC[11], NC_000009.11:g.98206793AC[12], NC_000009.11:g.98206793AC[13], NC_000009.11:g.98206793AC[14], NC_000009.11:g.98206793AC[16], NG_007664.1:g.77439TG[5], NG_007664.1:g.77439TG[6], NG_007664.1:g.77439TG[7], NG_007664.1:g.77439TG[8], NG_007664.1:g.77439TG[10], NG_007664.1:g.77439TG[11], NG_007664.1:g.77439TG[12], NG_007664.1:g.77439TG[13], NG_007664.1:g.77439TG[14], NG_007664.1:g.77439TG[16], NM_000264.5:c.*1866TG[5], NM_000264.5:c.*1866TG[6], NM_000264.5:c.*1866TG[7], NM_000264.5:c.*1866TG[8], NM_000264.5:c.*1866TG[10], NM_000264.5:c.*1866TG[11], NM_000264.5:c.*1866TG[12], NM_000264.5:c.*1866TG[13], NM_000264.5:c.*1866TG[14], NM_000264.5:c.*1866TG[16], NM_000264.4:c.*1866TG[5], NM_000264.4:c.*1866TG[6], NM_000264.4:c.*1866TG[7], NM_000264.4:c.*1866TG[8], NM_000264.4:c.*1866TG[10], NM_000264.4:c.*1866TG[11], NM_000264.4:c.*1866TG[12], NM_000264.4:c.*1866TG[13], NM_000264.4:c.*1866TG[14], NM_000264.4:c.*1866TG[16], NM_000264.3:c.*1866TG[5], NM_000264.3:c.*1866TG[6], NM_000264.3:c.*1866TG[7], NM_000264.3:c.*1866TG[8], NM_000264.3:c.*1866TG[10], NM_000264.3:c.*1866TG[11], NM_000264.3:c.*1866TG[12], NM_000264.3:c.*1866TG[13], NM_000264.3:c.*1866TG[14], NM_000264.3:c.*1866TG[16], NM_001083602.3:c.*1866TG[5], NM_001083602.3:c.*1866TG[6], NM_001083602.3:c.*1866TG[7], NM_001083602.3:c.*1866TG[8], NM_001083602.3:c.*1866TG[10], NM_001083602.3:c.*1866TG[11], NM_001083602.3:c.*1866TG[12], NM_001083602.3:c.*1866TG[13], NM_001083602.3:c.*1866TG[14], NM_001083602.3:c.*1866TG[16], NM_001083602.2:c.*1866TG[5], NM_001083602.2:c.*1866TG[6], NM_001083602.2:c.*1866TG[7], NM_001083602.2:c.*1866TG[8], NM_001083602.2:c.*1866TG[10], NM_001083602.2:c.*1866TG[11], NM_001083602.2:c.*1866TG[12], NM_001083602.2:c.*1866TG[13], NM_001083602.2:c.*1866TG[14], NM_001083602.2:c.*1866TG[16], NM_001083602.1:c.*1866TG[5], NM_001083602.1:c.*1866TG[6], NM_001083602.1:c.*1866TG[7], NM_001083602.1:c.*1866TG[8], NM_001083602.1:c.*1866TG[10], NM_001083602.1:c.*1866TG[11], NM_001083602.1:c.*1866TG[12], NM_001083602.1:c.*1866TG[13], NM_001083602.1:c.*1866TG[14], NM_001083602.1:c.*1866TG[16], NM_001083603.3:c.*1866TG[5], NM_001083603.3:c.*1866TG[6], NM_001083603.3:c.*1866TG[7], NM_001083603.3:c.*1866TG[8], NM_001083603.3:c.*1866TG[10], NM_001083603.3:c.*1866TG[11], NM_001083603.3:c.*1866TG[12], NM_001083603.3:c.*1866TG[13], NM_001083603.3:c.*1866TG[14], NM_001083603.3:c.*1866TG[16], NM_001083603.2:c.*1866TG[5], NM_001083603.2:c.*1866TG[6], NM_001083603.2:c.*1866TG[7], NM_001083603.2:c.*1866TG[8], NM_001083603.2:c.*1866TG[10], NM_001083603.2:c.*1866TG[11], NM_001083603.2:c.*1866TG[12], NM_001083603.2:c.*1866TG[13], NM_001083603.2:c.*1866TG[14], NM_001083603.2:c.*1866TG[16], NM_001083603.1:c.*1866TG[5], NM_001083603.1:c.*1866TG[6], NM_001083603.1:c.*1866TG[7], NM_001083603.1:c.*1866TG[8], NM_001083603.1:c.*1866TG[10], NM_001083603.1:c.*1866TG[11], NM_001083603.1:c.*1866TG[12], NM_001083603.1:c.*1866TG[13], NM_001083603.1:c.*1866TG[14], NM_001083603.1:c.*1866TG[16], NM_001083607.3:c.*1866TG[5], NM_001083607.3:c.*1866TG[6], NM_001083607.3:c.*1866TG[7], NM_001083607.3:c.*1866TG[8], NM_001083607.3:c.*1866TG[10], NM_001083607.3:c.*1866TG[11], NM_001083607.3:c.*1866TG[12], NM_001083607.3:c.*1866TG[13], NM_001083607.3:c.*1866TG[14], NM_001083607.3:c.*1866TG[16], NM_001083607.2:c.*1866TG[5], NM_001083607.2:c.*1866TG[6], NM_001083607.2:c.*1866TG[7], NM_001083607.2:c.*1866TG[8], NM_001083607.2:c.*1866TG[10], NM_001083607.2:c.*1866TG[11], NM_001083607.2:c.*1866TG[12], NM_001083607.2:c.*1866TG[13], NM_001083607.2:c.*1866TG[14], NM_001083607.2:c.*1866TG[16], NM_001083607.1:c.*1866TG[5], NM_001083607.1:c.*1866TG[6], NM_001083607.1:c.*1866TG[7], NM_001083607.1:c.*1866TG[8], NM_001083607.1:c.*1866TG[10], NM_001083607.1:c.*1866TG[11], NM_001083607.1:c.*1866TG[12], NM_001083607.1:c.*1866TG[13], NM_001083607.1:c.*1866TG[14], NM_001083607.1:c.*1866TG[16], NM_001083606.3:c.*1866TG[5], NM_001083606.3:c.*1866TG[6], NM_001083606.3:c.*1866TG[7], NM_001083606.3:c.*1866TG[8], NM_001083606.3:c.*1866TG[10], NM_001083606.3:c.*1866TG[11], NM_001083606.3:c.*1866TG[12], NM_001083606.3:c.*1866TG[13], NM_001083606.3:c.*1866TG[14], NM_001083606.3:c.*1866TG[16], NM_001083606.2:c.*1866TG[5], NM_001083606.2:c.*1866TG[6], NM_001083606.2:c.*1866TG[7], NM_001083606.2:c.*1866TG[8], NM_001083606.2:c.*1866TG[10], NM_001083606.2:c.*1866TG[11], NM_001083606.2:c.*1866TG[12], NM_001083606.2:c.*1866TG[13], NM_001083606.2:c.*1866TG[14], NM_001083606.2:c.*1866TG[16], NM_001083606.1:c.*1866TG[5], NM_001083606.1:c.*1866TG[6], NM_001083606.1:c.*1866TG[7], NM_001083606.1:c.*1866TG[8], NM_001083606.1:c.*1866TG[10], NM_001083606.1:c.*1866TG[11], NM_001083606.1:c.*1866TG[12], NM_001083606.1:c.*1866TG[13], NM_001083606.1:c.*1866TG[14], NM_001083606.1:c.*1866TG[16], NM_001083604.3:c.*1866TG[5], NM_001083604.3:c.*1866TG[6], NM_001083604.3:c.*1866TG[7], NM_001083604.3:c.*1866TG[8], NM_001083604.3:c.*1866TG[10], NM_001083604.3:c.*1866TG[11], NM_001083604.3:c.*1866TG[12], NM_001083604.3:c.*1866TG[13], NM_001083604.3:c.*1866TG[14], NM_001083604.3:c.*1866TG[16], NM_001083604.2:c.*1866TG[5], NM_001083604.2:c.*1866TG[6], NM_001083604.2:c.*1866TG[7], NM_001083604.2:c.*1866TG[8], NM_001083604.2:c.*1866TG[10], NM_001083604.2:c.*1866TG[11], NM_001083604.2:c.*1866TG[12], NM_001083604.2:c.*1866TG[13], NM_001083604.2:c.*1866TG[14], NM_001083604.2:c.*1866TG[16], NM_001083604.1:c.*1866TG[5], NM_001083604.1:c.*1866TG[6], NM_001083604.1:c.*1866TG[7], NM_001083604.1:c.*1866TG[8], NM_001083604.1:c.*1866TG[10], NM_001083604.1:c.*1866TG[11], NM_001083604.1:c.*1866TG[12], NM_001083604.1:c.*1866TG[13], NM_001083604.1:c.*1866TG[14], NM_001083604.1:c.*1866TG[16], NM_001083605.3:c.*1866TG[5], NM_001083605.3:c.*1866TG[6], NM_001083605.3:c.*1866TG[7], NM_001083605.3:c.*1866TG[8], NM_001083605.3:c.*1866TG[10], NM_001083605.3:c.*1866TG[11], NM_001083605.3:c.*1866TG[12], NM_001083605.3:c.*1866TG[13], NM_001083605.3:c.*1866TG[14], NM_001083605.3:c.*1866TG[16], NM_001083605.2:c.*1866TG[5], NM_001083605.2:c.*1866TG[6], NM_001083605.2:c.*1866TG[7], NM_001083605.2:c.*1866TG[8], NM_001083605.2:c.*1866TG[10], NM_001083605.2:c.*1866TG[11], NM_001083605.2:c.*1866TG[12], NM_001083605.2:c.*1866TG[13], NM_001083605.2:c.*1866TG[14], NM_001083605.2:c.*1866TG[16], NM_001083605.1:c.*1866TG[5], NM_001083605.1:c.*1866TG[6], NM_001083605.1:c.*1866TG[7], NM_001083605.1:c.*1866TG[8], NM_001083605.1:c.*1866TG[10], NM_001083605.1:c.*1866TG[11], NM_001083605.1:c.*1866TG[12], NM_001083605.1:c.*1866TG[13], NM_001083605.1:c.*1866TG[14], NM_001083605.1:c.*1866TG[16], NM_001354918.2:c.*1866TG[5], NM_001354918.2:c.*1866TG[6], NM_001354918.2:c.*1866TG[7], NM_001354918.2:c.*1866TG[8], NM_001354918.2:c.*1866TG[10], NM_001354918.2:c.*1866TG[11], NM_001354918.2:c.*1866TG[12], NM_001354918.2:c.*1866TG[13], NM_001354918.2:c.*1866TG[14], NM_001354918.2:c.*1866TG[16], NM_001354918.1:c.*1866TG[5], NM_001354918.1:c.*1866TG[6], NM_001354918.1:c.*1866TG[7], NM_001354918.1:c.*1866TG[8], NM_001354918.1:c.*1866TG[10], NM_001354918.1:c.*1866TG[11], NM_001354918.1:c.*1866TG[12], NM_001354918.1:c.*1866TG[13], NM_001354918.1:c.*1866TG[14], NM_001354918.1:c.*1866TG[16], NR_149061.2:n.6949TG[5], NR_149061.2:n.6949TG[6], NR_149061.2:n.6949TG[7], NR_149061.2:n.6949TG[8], NR_149061.2:n.6949TG[10], NR_149061.2:n.6949TG[11], NR_149061.2:n.6949TG[12], NR_149061.2:n.6949TG[13], NR_149061.2:n.6949TG[14], NR_149061.2:n.6949TG[16], NR_149061.1:n.6232TG[5], NR_149061.1:n.6232TG[6], NR_149061.1:n.6232TG[7], NR_149061.1:n.6232TG[8], NR_149061.1:n.6232TG[10], NR_149061.1:n.6232TG[11], NR_149061.1:n.6232TG[12], NR_149061.1:n.6232TG[13], NR_149061.1:n.6232TG[14], NR_149061.1:n.6232TG[16]
                                      20.

                                      rs1490995976 [Homo sapiens]
                                        Variant type:
                                        DELINS
                                        Alleles:
                                        TG>- [Show Flanks]
                                        Chromosome:
                                        9:95483385 (GRCh38)
                                        9:98245667 (GRCh37)
                                        Canonical SPDI:
                                        NC_000009.12:95483383:GTG:G
                                        Gene:
                                        PTCH1 (Varview)
                                        Functional Consequence:
                                        intron_variant
                                        Validated:
                                        by frequency,by alfa,by cluster
                                        MAF:
                                        G=0./0 (ALFA)
                                        -=0.000004/1 (TOPMED)
                                        -=0.000007/1 (GnomAD)
                                        HGVS:

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center