Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 990

1.

rs781679814 [Homo sapiens]
    Variant type:
    SNV
    Alleles:
    C>T [Show Flanks]
    Chromosome:
    12:52806982 (GRCh38)
    12:53200766 (GRCh37)
    Canonical SPDI:
    NC_000012.12:52806981:C:T
    Gene:
    KRT3 (Varview), KRT4 (Varview)
    Functional Consequence:
    upstream_transcript_variant,3_prime_UTR_variant,2KB_upstream_variant
    Validated:
    by frequency,by alfa,by cluster
    MAF:
    T=0.000054/1 (ALFA)
    T=0./0 (ALSPAC)
    T=0.000004/1 (TOPMED)
    T=0.000223/1 (Estonian)
    T=0.00027/1 (TWINSUK)
    HGVS:
    2.

    rs781631208 [Homo sapiens]
      Variant type:
      SNV
      Alleles:
      G>A,T [Show Flanks]
      Chromosome:
      12:52808824 (GRCh38)
      12:53202608 (GRCh37)
      Canonical SPDI:
      NC_000012.12:52808823:G:A,NC_000012.12:52808823:G:T
      Gene:
      KRT4 (Varview)
      Functional Consequence:
      coding_sequence_variant,synonymous_variant
      Validated:
      by frequency,by alfa,by cluster
      MAF:
      T=0.000071/1 (ALFA)
      T=0.000004/1 (TOPMED)
      HGVS:
      3.

      rs781543522 [Homo sapiens]
        Variant type:
        SNV
        Alleles:
        C>A [Show Flanks]
        Chromosome:
        12:52808890 (GRCh38)
        12:53202674 (GRCh37)
        Canonical SPDI:
        NC_000012.12:52808889:C:A
        Gene:
        KRT4 (Varview)
        Functional Consequence:
        intron_variant
        Validated:
        by frequency,by alfa,by cluster
        MAF:
        A=0./0 (ALFA)
        A=0.000004/1 (GnomAD_exomes)
        A=0.000004/1 (TOPMED)
        A=0.000008/1 (ExAC)
        A=0.000021/3 (GnomAD)
        HGVS:
        4.

        rs781431141 [Homo sapiens]
          Variant type:
          DEL
          Alleles:
          G>- [Show Flanks]
          Chromosome:
          12:52807126 (GRCh38)
          12:53200910 (GRCh37)
          Canonical SPDI:
          NC_000012.12:52807125:G:
          Gene:
          KRT3 (Varview), KRT4 (Varview)
          Functional Consequence:
          upstream_transcript_variant,2KB_upstream_variant,coding_sequence_variant,frameshift_variant
          Validated:
          by frequency,by alfa,by cluster
          MAF:
          -=0./0 (ALFA)
          -=0.000008/1 (ExAC)
          -=0.000015/4 (TOPMED)
          -=0.00002/5 (GnomAD_exomes)
          -=0.000021/3 (GnomAD)
          HGVS:
          5.

          rs781402774 [Homo sapiens]
            Variant type:
            SNV
            Alleles:
            C>T [Show Flanks]
            Chromosome:
            12:52808015 (GRCh38)
            12:53201799 (GRCh37)
            Canonical SPDI:
            NC_000012.12:52808014:C:T
            Gene:
            KRT4 (Varview)
            Functional Consequence:
            intron_variant
            Validated:
            by frequency,by alfa,by cluster
            MAF:
            T=0.000071/1 (ALFA)
            T=0.000049/13 (TOPMED)
            T=0.00005/7 (GnomAD)
            T=0.000259/1 (ALSPAC)
            T=0.00027/1 (TWINSUK)
            HGVS:
            6.

            rs781336821 [Homo sapiens]
              Variant type:
              SNV
              Alleles:
              A>G [Show Flanks]
              Chromosome:
              12:52813258 (GRCh38)
              12:53207042 (GRCh37)
              Canonical SPDI:
              NC_000012.12:52813257:A:G
              Gene:
              KRT4 (Varview)
              Functional Consequence:
              intron_variant
              Validated:
              by frequency,by alfa,by cluster
              MAF:
              G=0./0 (ALFA)
              G=0./0 (ALSPAC)
              G=0.000008/2 (TOPMED)
              G=0.000014/2 (GnomAD)
              G=0.00027/1 (TWINSUK)
              HGVS:
              7.

              rs781333934 [Homo sapiens]
                Variant type:
                SNV
                Alleles:
                G>C [Show Flanks]
                Chromosome:
                12:52808690 (GRCh38)
                12:53202474 (GRCh37)
                Canonical SPDI:
                NC_000012.12:52808689:G:C
                Gene:
                KRT4 (Varview)
                Functional Consequence:
                coding_sequence_variant,missense_variant
                Validated:
                by frequency,by cluster
                MAF:
                C=0.000004/1 (GnomAD_exomes)
                C=0.000008/1 (ExAC)
                HGVS:
                8.

                rs781215136 [Homo sapiens]
                  Variant type:
                  SNV
                  Alleles:
                  G>A,C,T [Show Flanks]
                  Chromosome:
                  12:52814382 (GRCh38)
                  12:53208166 (GRCh37)
                  Canonical SPDI:
                  NC_000012.12:52814381:G:A,NC_000012.12:52814381:G:C,NC_000012.12:52814381:G:T
                  Gene:
                  KRT4 (Varview)
                  Functional Consequence:
                  upstream_transcript_variant,2KB_upstream_variant
                  Validated:
                  by frequency,by alfa,by cluster
                  MAF:
                  C=0./0 (ALFA)
                  A=0./0 (ALSPAC)
                  A=0.00027/1 (TWINSUK)
                  HGVS:
                  9.

                  rs781098959 [Homo sapiens]
                    Variant type:
                    SNV
                    Alleles:
                    T>C [Show Flanks]
                    Chromosome:
                    12:52810633 (GRCh38)
                    12:53204417 (GRCh37)
                    Canonical SPDI:
                    NC_000012.12:52810632:T:C
                    Gene:
                    KRT4 (Varview)
                    Functional Consequence:
                    intron_variant
                    Validated:
                    by frequency,by alfa,by cluster
                    MAF:
                    C=0./0 (ALFA)
                    C=0./0 (ALSPAC)
                    C=0.000004/1 (TOPMED)
                    C=0.00027/1 (TWINSUK)
                    HGVS:
                    10.

                    rs781063765 [Homo sapiens]
                      Variant type:
                      SNV
                      Alleles:
                      G>A [Show Flanks]
                      Chromosome:
                      12:52813938 (GRCh38)
                      12:53207722 (GRCh37)
                      Canonical SPDI:
                      NC_000012.12:52813937:G:A
                      Gene:
                      KRT4 (Varview)
                      Functional Consequence:
                      coding_sequence_variant,stop_gained
                      Validated:
                      by frequency,by alfa,by cluster
                      MAF:
                      A=0.000043/1 (ALFA)
                      A=0.000015/4 (TOPMED)
                      A=0.000024/6 (GnomAD_exomes)
                      A=0.000025/3 (ExAC)
                      A=0.000684/2 (KOREAN)
                      HGVS:
                      11.

                      rs781060860 [Homo sapiens]
                        Variant type:
                        DELINS
                        Alleles:
                        ->GAAACCAGCTCCGAAGCCGCCGGCACCAAAGCCACCAATGCC [Show Flanks]
                        Chromosome:
                        12:52813814 (GRCh38)
                        12:53207599 (GRCh37)
                        Canonical SPDI:
                        NC_000012.12:52813814:TGCC:TGCCGAAACCAGCTCCGAAGCCGCCGGCACCAAAGCCACCAATGCC
                        Gene:
                        KRT4 (Varview)
                        Functional Consequence:
                        coding_sequence_variant,inframe_insertion
                        Validated:
                        by frequency,by cluster
                        MAF:
                        TGCCGAAACCAGCTCCGAAGCCGCCGGCACCAAAGCCACCAA=0.00003/1 (ExAC)
                        TGCCGAAACCAGCTCCGAAGCCGCCGGCACCAAAGCCACCAA=0.00004/2 (GnomAD_exomes)
                        HGVS:
                        12.

                        rs780851356 [Homo sapiens]
                          Variant type:
                          SNV
                          Alleles:
                          G>A [Show Flanks]
                          Chromosome:
                          12:52808434 (GRCh38)
                          12:53202218 (GRCh37)
                          Canonical SPDI:
                          NC_000012.12:52808433:G:A
                          Gene:
                          KRT4 (Varview)
                          Functional Consequence:
                          intron_variant
                          Validated:
                          by frequency,by cluster
                          MAF:
                          A=0.000004/1 (GnomAD_exomes)
                          A=0.000008/1 (ExAC)
                          HGVS:
                          13.

                          rs780817011 [Homo sapiens]
                            Variant type:
                            SNV
                            Alleles:
                            T>A,C [Show Flanks]
                            Chromosome:
                            12:52809167 (GRCh38)
                            12:53202951 (GRCh37)
                            Canonical SPDI:
                            NC_000012.12:52809166:T:A,NC_000012.12:52809166:T:C
                            Gene:
                            KRT4 (Varview)
                            Functional Consequence:
                            intron_variant
                            Validated:
                            by frequency,by alfa,by cluster
                            MAF:
                            C=0./0 (ALFA)
                            C=0.000004/1 (TOPMED)
                            A=0.025/1 (GENOME_DK)
                            HGVS:
                            14.

                            rs780769902 [Homo sapiens]
                              Variant type:
                              SNV
                              Alleles:
                              A>C,G [Show Flanks]
                              Chromosome:
                              12:52813831 (GRCh38)
                              12:53207615 (GRCh37)
                              Canonical SPDI:
                              NC_000012.12:52813830:A:C,NC_000012.12:52813830:A:G
                              Gene:
                              KRT4 (Varview)
                              Functional Consequence:
                              coding_sequence_variant,synonymous_variant
                              Validated:
                              by frequency,by cluster
                              MAF:
                              G=0.00001/1 (ExAC)
                              C=0.00114/2 (Korea1K)
                              HGVS:
                              15.

                              rs780754412 [Homo sapiens]
                                Variant type:
                                SNV
                                Alleles:
                                C>T [Show Flanks]
                                Chromosome:
                                12:52813602 (GRCh38)
                                12:53207386 (GRCh37)
                                Canonical SPDI:
                                NC_000012.12:52813601:C:T
                                Gene:
                                KRT4 (Varview)
                                Functional Consequence:
                                coding_sequence_variant,missense_variant
                                Clinical significance:
                                uncertain-significance
                                Validated:
                                by frequency,by alfa,by cluster
                                MAF:
                                T=0./0 (ALFA)
                                T=0.000004/1 (GnomAD_exomes)
                                T=0.000008/1 (ExAC)
                                T=0.000014/2 (GnomAD)
                                T=0.000034/9 (TOPMED)
                                T=0.000537/9 (TOMMO)
                                HGVS:
                                16.

                                rs780655796 [Homo sapiens]
                                  Variant type:
                                  SNV
                                  Alleles:
                                  C>T [Show Flanks]
                                  Chromosome:
                                  12:52811978 (GRCh38)
                                  12:53205762 (GRCh37)
                                  Canonical SPDI:
                                  NC_000012.12:52811977:C:T
                                  Gene:
                                  KRT4 (Varview)
                                  Functional Consequence:
                                  splice_acceptor_variant
                                  Validated:
                                  by frequency,by cluster
                                  MAF:
                                  T=0.000008/2 (GnomAD_exomes)
                                  T=0.00002/2 (ExAC)
                                  HGVS:
                                  17.

                                  rs780498757 [Homo sapiens]
                                    Variant type:
                                    SNV
                                    Alleles:
                                    C>T [Show Flanks]
                                    Chromosome:
                                    12:52807413 (GRCh38)
                                    12:53201197 (GRCh37)
                                    Canonical SPDI:
                                    NC_000012.12:52807412:C:T
                                    Gene:
                                    KRT3 (Varview), KRT4 (Varview)
                                    Functional Consequence:
                                    upstream_transcript_variant,intron_variant,2KB_upstream_variant
                                    Validated:
                                    by frequency,by alfa,by cluster
                                    MAF:
                                    T=0.000071/1 (ALFA)
                                    T=0.000008/1 (ExAC)
                                    T=0.000012/3 (GnomAD_exomes)
                                    T=0.000014/2 (GnomAD)
                                    T=0.000023/6 (TOPMED)
                                    HGVS:
                                    18.

                                    rs780490204 [Homo sapiens]
                                      Variant type:
                                      SNV
                                      Alleles:
                                      A>T [Show Flanks]
                                      Chromosome:
                                      12:52809332 (GRCh38)
                                      12:53203116 (GRCh37)
                                      Canonical SPDI:
                                      NC_000012.12:52809331:A:T
                                      Gene:
                                      KRT4 (Varview)
                                      Functional Consequence:
                                      intron_variant
                                      Validated:
                                      by frequency,by cluster
                                      MAF:
                                      T=0.000008/2 (GnomAD_exomes)
                                      T=0.000017/2 (ExAC)
                                      HGVS:
                                      19.

                                      rs780405626 [Homo sapiens]
                                        Variant type:
                                        SNV
                                        Alleles:
                                        C>T [Show Flanks]
                                        Chromosome:
                                        12:52806638 (GRCh38)
                                        12:53200422 (GRCh37)
                                        Canonical SPDI:
                                        NC_000012.12:52806637:C:T
                                        Gene:
                                        KRT3 (Varview), KRT4 (Varview)
                                        Functional Consequence:
                                        upstream_transcript_variant,3_prime_UTR_variant,2KB_upstream_variant
                                        Validated:
                                        by frequency,by alfa,by cluster
                                        MAF:
                                        T=0./0 (ALFA)
                                        T=0./0 (TWINSUK)
                                        T=0.000019/5 (TOPMED)
                                        T=0.000021/3 (GnomAD)
                                        T=0.000259/1 (ALSPAC)
                                        HGVS:
                                        20.

                                        rs780311581 [Homo sapiens]
                                          Variant type:
                                          SNV
                                          Alleles:
                                          C>T [Show Flanks]
                                          Chromosome:
                                          12:52807829 (GRCh38)
                                          12:53201613 (GRCh37)
                                          Canonical SPDI:
                                          NC_000012.12:52807828:C:T
                                          Gene:
                                          KRT4 (Varview)
                                          Functional Consequence:
                                          coding_sequence_variant,synonymous_variant
                                          Validated:
                                          by frequency,by cluster
                                          MAF:
                                          T=0.000004/1 (GnomAD_exomes)
                                          T=0.000008/1 (ExAC)
                                          HGVS:

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center