Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 3453

1.

rs781681261 [Homo sapiens]
    Variant type:
    SNV
    Alleles:
    A>G [Show Flanks]
    Chromosome:
    15:28523917 (GRCh38)
    15:28769063 (GRCh37)
    Canonical SPDI:
    NC_000015.10:28523916:A:G
    Gene:
    GOLGA8G (Varview)
    Functional Consequence:
    intron_variant
    Validated:
    by frequency,by alfa,by cluster
    MAF:
    G=0./0 (ALFA)
    G=0.000013/1 (GnomAD)
    G=0.000015/2 (GnomAD_exomes)
    G=0.000051/3 (ExAC)
    HGVS:
    2.

    rs781608987 [Homo sapiens]
      Variant type:
      SNV
      Alleles:
      G>A [Show Flanks]
      Chromosome:
      15:28479980 (GRCh38)
      15:28725126 (GRCh37)
      Canonical SPDI:
      NC_000015.10:28479979:G:A
      Validated:
      by frequency,by alfa,by cluster
      MAF:
      A=0.000169/2 (ALFA)
      G=0./0 (SGDP_PRJ)
      A=0.000252/27 (GnomAD)
      A=0.007727/104 (TOMMO)
      A=0.024306/56 (KOREAN)
      A=0.025/1 (GENOME_DK)
      HGVS:
      3.

      rs781484089 [Homo sapiens]
        Variant type:
        DELINS
        Alleles:
        GAGCAGCAGGAGAGGCTTCCAGAGCAGGAGGAGAGGCTTCAG>-,GAGCAGCAGGAGAGGCTTCCAGAGCAGGAGGAGAGGCTTCAGGAGCAGCAGGAGAGGCTTCCAGAGCAGGAGGAGAGGCTTCAG [Show Flanks]
        Chromosome:
        15:28385304 (GRCh38)
        15:28630450 (GRCh37)
        Canonical SPDI:
        NC_000015.10:28385282:GAGCAGGAGGAGAGGCTTCAGGAGCAGCAGGAGAGGCTTCCAGAGCAGGAGGAGAGGCTTCAG:GAGCAGGAGGAGAGGCTTCAG,NC_000015.10:28385282:GAGCAGGAGGAGAGGCTTCAGGAGCAGCAGGAGAGGCTTCCAGAGCAGGAGGAGAGGCTTCAG:GAGCAGGAGGAGAGGCTTCAGGAGCAGCAGGAGAGGCTTCCAGAGCAGGAGGAGAGGCTTCAGGAGCAGCAGGAGAGGCTTCCAGAGCAGGAGGAGAGGCTTCAG
        Gene:
        GOLGA8F (Varview)
        Functional Consequence:
        non_coding_transcript_variant,inframe_insertion,coding_sequence_variant,inframe_deletion
        Validated:
        by frequency,by cluster
        MAF:
        -=0./0 (ExAC)
        GAGCAGGAGGAGAGGCTTCAGGAGCAGCAGGAGAGGCTTCCA=0.00006/1 (TOMMO)
        HGVS:
        NC_000015.10:g.28385304_28385345del, NC_000015.10:g.28385304_28385345dup, NC_000015.9:g.28630450_28630491del, NC_000015.9:g.28630450_28630491dup, NW_011332701.1:g.518699_518740del, NW_011332701.1:g.518699_518740dup, NT_187660.1:g.632485_632526del, NT_187660.1:g.632485_632526dup, NW_003315943.1:g.73229_73270del, NW_003315943.1:g.73229_73270dup, NR_033351.2:n.1454_1495del, NR_033351.2:n.1454_1495dup, NR_033351.1:n.1454_1495del, NR_033351.1:n.1454_1495dup, NM_001350920.2:c.1057_1098del, NM_001350920.2:c.1057_1098dup, NM_001350920.1:c.1093_1134del, NM_001350920.1:c.1093_1134dup, NM_001164328.1:c.439_480del, NM_001164328.1:c.439_480dup, XM_024449812.1:c.439_480del, XM_024449812.1:c.439_480dup, XM_024449811.1:c.439_480del, XM_024449811.1:c.439_480dup, XM_024449813.1:c.439_480del, XM_024449813.1:c.439_480dup, XM_024449809.1:c.1090_1131del, XM_024449809.1:c.1090_1131dup, XM_024449810.1:c.439_480del, XM_024449810.1:c.439_480dup, XR_002957623.1:n.1155_1196del, XR_002957623.1:n.1155_1196dup, XM_024449808.1:c.1093_1134del, XM_024449808.1:c.1093_1134dup, NP_001337849.2:p.Glu353_Gln366del, NP_001337849.2:p.Glu353_Gln366dup, XP_024305580.1:p.Glu147_Gln160del, XP_024305580.1:p.Glu147_Gln160dup, XP_024305579.1:p.Glu147_Gln160del, XP_024305579.1:p.Glu147_Gln160dup, XP_024305581.1:p.Glu147_Gln160del, XP_024305581.1:p.Glu147_Gln160dup, XP_024305577.1:p.Glu364_Gln377del, XP_024305577.1:p.Glu364_Gln377dup, XP_024305578.1:p.Glu147_Gln160del, XP_024305578.1:p.Glu147_Gln160dup, XP_024305576.1:p.Glu365_Gln378del, XP_024305576.1:p.Glu365_Gln378dup
        5.

        rs781391413 [Homo sapiens]
          Variant type:
          SNV
          Alleles:
          C>A [Show Flanks]
          Chromosome:
          15:28568208 (GRCh38)
          15:28813354 (GRCh37)
          Canonical SPDI:
          NC_000015.10:28568207:C:A
          Validated:
          by frequency,by alfa,by cluster
          MAF:
          A=0.00017/2 (ALFA)
          A=0.00035/16 (GnomAD)
          A=0.025/1 (GENOME_DK)
          HGVS:
          6.

          rs781299880 [Homo sapiens]
            Variant type:
            SNV
            Alleles:
            G>T [Show Flanks]
            Chromosome:
            15:28560698 (GRCh38)
            15:28805844 (GRCh37)
            Canonical SPDI:
            NC_000015.10:28560697:G:T
            Gene:
            LOC100132202 (Varview)
            Functional Consequence:
            coding_sequence_variant,missense_variant
            Validated:
            by frequency,by alfa,by cluster
            MAF:
            T=0./0 (ALFA)
            T=0.000009/1 (GnomAD)
            T=0.000067/1 (ExAC)
            HGVS:
            7.

            rs781260808 [Homo sapiens]
              Variant type:
              DEL
              Alleles:
              CAC>- [Show Flanks]
              Chromosome:
              15:28450983 (GRCh38)
              15:28696129 (GRCh37)
              Canonical SPDI:
              NC_000015.10:28450982:CAC:
              Validated:
              by frequency,by alfa,by cluster
              MAF:
              -=0.46101/1549 (ALFA)
              -=0.05696/90 (Korea1K)
              CAC=0.35814/1328 (TWINSUK)
              CAC=0.36196/1395 (ALSPAC)
              CAC=0.46274/7612 (TOMMO)
              HGVS:
              8.

              rs781225773 [Homo sapiens]
                Variant type:
                SNV
                Alleles:
                G>A,C,T [Show Flanks]
                Chromosome:
                15:28498217 (GRCh38)
                15:28743363 (GRCh37)
                Canonical SPDI:
                NC_000015.10:28498216:G:A,NC_000015.10:28498216:G:C,NC_000015.10:28498216:G:T
                Validated:
                by frequency,by alfa,by cluster
                MAF:
                T=0./0 (ALFA)
                C=0.005/3 (NorthernSweden)
                C=0.00758/127 (TOMMO)
                C=0.02156/63 (KOREAN)
                G=0.5/15 (SGDP_PRJ)
                HGVS:
                9.

                rs781201430 [Homo sapiens]
                  Variant type:
                  DELINS
                  Alleles:
                  GA>- [Show Flanks]
                  Chromosome:
                  15:28526563 (GRCh38)
                  15:28771709 (GRCh37)
                  Canonical SPDI:
                  NC_000015.10:28526561:AGA:A
                  Gene:
                  GOLGA8G (Varview)
                  Functional Consequence:
                  intron_variant
                  Validated:
                  by frequency,by alfa,by cluster
                  MAF:
                  A=0.00076/9 (ALFA)
                  -=0.01029/254 (ExAC)
                  -=0.43471/3249 (GoESP)
                  HGVS:
                  10.

                  rs781157123 [Homo sapiens]
                    Variant type:
                    DELINS
                    Alleles:
                    GA>- [Show Flanks]
                    Chromosome:
                    15:28488117 (GRCh38)
                    15:28733263 (GRCh37)
                    Canonical SPDI:
                    NC_000015.10:28488115:AGA:A
                    Validated:
                    by frequency,by alfa,by cluster
                    MAF:
                    A=0.35593/4222 (ALFA)
                    -=0.125/5 (GENOME_DK)
                    -=0.37173/6016 (TOMMO)
                    HGVS:
                    11.

                    rs781128859 [Homo sapiens]
                      Variant type:
                      SNV
                      Alleles:
                      A>C [Show Flanks]
                      Chromosome:
                      15:28387588 (GRCh38)
                      15:28632734 (GRCh37)
                      Canonical SPDI:
                      NC_000015.10:28387587:A:C
                      Gene:
                      GOLGA8F (Varview)
                      Functional Consequence:
                      intron_variant
                      Validated:
                      by frequency,by alfa,by cluster
                      MAF:
                      C=0./0 (ALFA)
                      C=0.000034/4 (GnomAD)
                      C=0.000099/18 (GnomAD_exomes)
                      C=0.000144/5 (ExAC)
                      C=0.000358/6 (TOMMO)
                      HGVS:
                      12.

                      rs781060665 has merged into rs371553202 [Homo sapiens]
                        Variant type:
                        DELINS
                        Alleles:
                        ATATATATATATATAT>-,AT,ATAT,ATATAT,ATATATAT,ATATATATAT,ATATATATATAT,ATATATATATATAT,ATATATATATATATATAT,ATATATATATATATATATAT,ATATATATATATATATATATAT,ATATATATATATATATATATATAT,ATATATATATATATATATATATATAT,ATATATATATATATATATATATATATAT,ATATATATATATATATATATATATATATAT [Show Flanks]
                        Chromosome:
                        15:28440176 (GRCh38)
                        15:28685322 (GRCh37)
                        Canonical SPDI:
                        NC_000015.10:28440162:TATATATATATATATATATATATATATAT:TATATATATATAT,NC_000015.10:28440162:TATATATATATATATATATATATATATAT:TATATATATATATAT,NC_000015.10:28440162:TATATATATATATATATATATATATATAT:TATATATATATATATAT,NC_000015.10:28440162:TATATATATATATATATATATATATATAT:TATATATATATATATATAT,NC_000015.10:28440162:TATATATATATATATATATATATATATAT:TATATATATATATATATATAT,NC_000015.10:28440162:TATATATATATATATATATATATATATAT:TATATATATATATATATATATAT,NC_000015.10:28440162:TATATATATATATATATATATATATATAT:TATATATATATATATATATATATAT,NC_000015.10:28440162:TATATATATATATATATATATATATATAT:TATATATATATATATATATATATATAT,NC_000015.10:28440162:TATATATATATATATATATATATATATAT:TATATATATATATATATATATATATATATAT,NC_000015.10:28440162:TATATATATATATATATATATATATATAT:TATATATATATATATATATATATATATATATAT,NC_000015.10:28440162:TATATATATATATATATATATATATATAT:TATATATATATATATATATATATATATATATATAT,NC_000015.10:28440162:TATATATATATATATATATATATATATAT:TATATATATATATATATATATATATATATATATATAT,NC_000015.10:28440162:TATATATATATATATATATATATATATAT:TATATATATATATATATATATATATATATATATATATAT,NC_000015.10:28440162:TATATATATATATATATATATATATATAT:TATATATATATATATATATATATATATATATATATATATAT,NC_000015.10:28440162:TATATATATATATATATATATATATATAT:TATATATATATATATATATATATATATATATATATATATATAT
                        Validated:
                        by frequency,by alfa,by cluster
                        MAF:
                        TATATATATATATAT=0./0 (ALFA)
                        -=0.1842/7 (GENOME_DK)
                        HGVS:
                        NC_000015.10:g.28440164AT[6], NC_000015.10:g.28440164AT[7], NC_000015.10:g.28440164AT[8], NC_000015.10:g.28440164AT[9], NC_000015.10:g.28440164AT[10], NC_000015.10:g.28440164AT[11], NC_000015.10:g.28440164AT[12], NC_000015.10:g.28440164AT[13], NC_000015.10:g.28440164AT[15], NC_000015.10:g.28440164AT[16], NC_000015.10:g.28440164AT[17], NC_000015.10:g.28440164AT[18], NC_000015.10:g.28440164AT[19], NC_000015.10:g.28440164AT[20], NC_000015.10:g.28440164AT[21], NC_000015.9:g.28685310AT[6], NC_000015.9:g.28685310AT[7], NC_000015.9:g.28685310AT[8], NC_000015.9:g.28685310AT[9], NC_000015.9:g.28685310AT[10], NC_000015.9:g.28685310AT[11], NC_000015.9:g.28685310AT[12], NC_000015.9:g.28685310AT[13], NC_000015.9:g.28685310AT[15], NC_000015.9:g.28685310AT[16], NC_000015.9:g.28685310AT[17], NC_000015.9:g.28685310AT[18], NC_000015.9:g.28685310AT[19], NC_000015.9:g.28685310AT[20], NC_000015.9:g.28685310AT[21], NW_011332701.1:g.601998AT[10], NW_011332701.1:g.601998AT[11], NW_011332701.1:g.601998AT[12], NW_011332701.1:g.601998AT[13], NW_011332701.1:g.601998AT[14], NW_011332701.1:g.601998AT[15], NW_011332701.1:g.601998AT[16], NW_011332701.1:g.601998AT[17], NW_011332701.1:g.601998AT[19], NW_011332701.1:g.601998AT[20], NW_011332701.1:g.601998AT[21], NW_011332701.1:g.601998AT[22], NW_011332701.1:g.601998AT[23], NW_011332701.1:g.601998AT[24], NW_011332701.1:g.601998AT[25], NT_187660.1:g.715784AT[10], NT_187660.1:g.715784AT[11], NT_187660.1:g.715784AT[12], NT_187660.1:g.715784AT[13], NT_187660.1:g.715784AT[14], NT_187660.1:g.715784AT[15], NT_187660.1:g.715784AT[16], NT_187660.1:g.715784AT[17], NT_187660.1:g.715784AT[19], NT_187660.1:g.715784AT[20], NT_187660.1:g.715784AT[21], NT_187660.1:g.715784AT[22], NT_187660.1:g.715784AT[23], NT_187660.1:g.715784AT[24], NT_187660.1:g.715784AT[25], NW_003315943.1:g.139440AT[12], NW_003315943.1:g.139440AT[13], NW_003315943.1:g.139440AT[14], NW_003315943.1:g.139440AT[15], NW_003315943.1:g.139440AT[16], NW_003315943.1:g.139440AT[17], NW_003315943.1:g.139440AT[18], NW_003315943.1:g.139440AT[19], NW_003315943.1:g.139440AT[21], NW_003315943.1:g.139440AT[22], NW_003315943.1:g.139440AT[23], NW_003315943.1:g.139440AT[24], NW_003315943.1:g.139440AT[25], NW_003315943.1:g.139440AT[26], NW_003315943.1:g.139440AT[27]
                        13.

                        rs781039154 [Homo sapiens]
                          Variant type:
                          SNV
                          Alleles:
                          C>A,T [Show Flanks]
                          Chromosome:
                          15:28387641 (GRCh38)
                          15:28632787 (GRCh37)
                          Canonical SPDI:
                          NC_000015.10:28387640:C:A,NC_000015.10:28387640:C:T
                          Gene:
                          GOLGA8F (Varview)
                          Functional Consequence:
                          missense_variant,non_coding_transcript_variant,coding_sequence_variant,intron_variant
                          Validated:
                          by frequency,by alfa
                          MAF:
                          A=0.000112/1 (ALFA)
                          T=0.00001/1 (ExAC)
                          HGVS:
                          NC_000015.10:g.28387641C>A, NC_000015.10:g.28387641C>T, NC_000015.9:g.28632787C>A, NC_000015.9:g.28632787C>T, NW_011332701.1:g.521036C>A, NW_011332701.1:g.521036C>T, NT_187660.1:g.634822C>A, NT_187660.1:g.634822C>T, NW_003315943.1:g.75566C>A, NW_003315943.1:g.75566C>T, NR_033351.2:n.1716C>A, NR_033351.2:n.1716C>T, NR_033351.1:n.1716C>A, NR_033351.1:n.1716C>T, NM_001350920.2:c.1319C>A, NM_001350920.2:c.1319C>T, NM_001350920.1:c.1355C>A, NM_001350920.1:c.1355C>T, NM_001164328.1:c.701C>A, NM_001164328.1:c.701C>T, XM_024449812.1:c.701C>A, XM_024449812.1:c.701C>T, XM_024449811.1:c.701C>A, XM_024449811.1:c.701C>T, XM_024449813.1:c.701C>A, XM_024449813.1:c.701C>T, XM_024449809.1:c.1352C>A, XM_024449809.1:c.1352C>T, XM_024449810.1:c.701C>A, XM_024449810.1:c.701C>T, XM_024449808.1:c.1355C>A, XM_024449808.1:c.1355C>T, NP_001337849.2:p.Ala440Glu, NP_001337849.2:p.Ala440Val, XP_024305580.1:p.Ala234Glu, XP_024305580.1:p.Ala234Val, XP_024305579.1:p.Ala234Glu, XP_024305579.1:p.Ala234Val, XP_024305581.1:p.Ala234Glu, XP_024305581.1:p.Ala234Val, XP_024305577.1:p.Ala451Glu, XP_024305577.1:p.Ala451Val, XP_024305578.1:p.Ala234Glu, XP_024305578.1:p.Ala234Val, XP_024305576.1:p.Ala452Glu, XP_024305576.1:p.Ala452Val
                          14.

                          rs781036359 has merged into rs200022350 [Homo sapiens]
                            Variant type:
                            DELINS
                            Alleles:
                            CCCCCC>-,CC,CCC,CCCC,CCCCC,CCCCCCC,CCCCCCCC,CCCCCCCCC,CCCCCCCCCC,CCCCCCCCCCC,CCCCCCCCCCCC [Show Flanks]
                            Chromosome:
                            15:28399632 (GRCh38)
                            15:28644778 (GRCh37)
                            Canonical SPDI:
                            NC_000015.10:28399626:CCCCCCCCCCC:CCCCC,NC_000015.10:28399626:CCCCCCCCCCC:CCCCCCC,NC_000015.10:28399626:CCCCCCCCCCC:CCCCCCCC,NC_000015.10:28399626:CCCCCCCCCCC:CCCCCCCCC,NC_000015.10:28399626:CCCCCCCCCCC:CCCCCCCCCC,NC_000015.10:28399626:CCCCCCCCCCC:CCCCCCCCCCCC,NC_000015.10:28399626:CCCCCCCCCCC:CCCCCCCCCCCCC,NC_000015.10:28399626:CCCCCCCCCCC:CCCCCCCCCCCCCC,NC_000015.10:28399626:CCCCCCCCCCC:CCCCCCCCCCCCCCC,NC_000015.10:28399626:CCCCCCCCCCC:CCCCCCCCCCCCCCCC,NC_000015.10:28399626:CCCCCCCCCCC:CCCCCCCCCCCCCCCCC
                            Validated:
                            by frequency,by alfa,by cluster
                            MAF:
                            CCCCCCC=0./0 (ALFA)
                            -=0.000008/2 (TOPMED)
                            -=0.055556/2 (GENOME_DK)
                            HGVS:
                            15.

                            rs780946061 [Homo sapiens]
                              Variant type:
                              SNV
                              Alleles:
                              C>A [Show Flanks]
                              Chromosome:
                              15:28345328 (GRCh38)
                              15:28590474 (GRCh37)
                              Canonical SPDI:
                              NC_000015.10:28345327:C:A
                              Validated:
                              by frequency
                              MAF:
                              A=0.03/1 (GENOME_DK)
                              HGVS:
                              16.

                              rs780933053 [Homo sapiens]
                                Variant type:
                                SNV
                                Alleles:
                                C>T [Show Flanks]
                                Chromosome:
                                15:28526408 (GRCh38)
                                15:28771554 (GRCh37)
                                Canonical SPDI:
                                NC_000015.10:28526407:C:T
                                Gene:
                                GOLGA8G (Varview)
                                Functional Consequence:
                                non_coding_transcript_variant,synonymous_variant,coding_sequence_variant
                                Validated:
                                by frequency,by alfa,by cluster
                                MAF:
                                T=0.00914/123 (ALFA)
                                T=0.00178/5 (ExAC)
                                HGVS:
                                17.

                                rs780921864 [Homo sapiens]
                                  Variant type:
                                  SNV
                                  Alleles:
                                  T>C [Show Flanks]
                                  Chromosome:
                                  15:28525875 (GRCh38)
                                  15:28771021 (GRCh37)
                                  Canonical SPDI:
                                  NC_000015.10:28525874:T:C
                                  Gene:
                                  GOLGA8G (Varview)
                                  Functional Consequence:
                                  intron_variant
                                  Validated:
                                  by frequency,by cluster
                                  MAF:
                                  C=0./0 (ExAC)
                                  HGVS:
                                  18.

                                  rs780819063 [Homo sapiens]
                                    Variant type:
                                    SNV
                                    Alleles:
                                    T>A [Show Flanks]
                                    Chromosome:
                                    15:28491302 (GRCh38)
                                    15:28736448 (GRCh37)
                                    Canonical SPDI:
                                    NC_000015.10:28491301:T:A
                                    Gene:
                                    MIR4509-3 (Varview)
                                    Functional Consequence:
                                    upstream_transcript_variant,2KB_upstream_variant
                                    Validated:
                                    by frequency,by alfa,by cluster
                                    MAF:
                                    A=0.041452/677 (ALFA)
                                    A=0.025/1 (GENOME_DK)
                                    A=0.03199/535 (TOMMO)
                                    A=0.043337/4816 (GnomAD)
                                    A=0.058333/35 (NorthernSweden)
                                    A=0.067978/197 (KOREAN)
                                    A=0.099057/21 (Qatari)
                                    T=0.488372/42 (SGDP_PRJ)
                                    HGVS:
                                    19.

                                    rs780761875 [Homo sapiens]
                                      Variant type:
                                      SNV
                                      Alleles:
                                      C>A,T [Show Flanks]
                                      Chromosome:
                                      15:28525811 (GRCh38)
                                      15:28770957 (GRCh37)
                                      Canonical SPDI:
                                      NC_000015.10:28525810:C:A,NC_000015.10:28525810:C:T
                                      Gene:
                                      GOLGA8G (Varview)
                                      Functional Consequence:
                                      intron_variant
                                      Validated:
                                      by frequency,by alfa,by cluster
                                      MAF:
                                      T=0./0 (ALFA)
                                      T=0.006906/957 (GnomAD)
                                      T=0.007491/4 (MGP)
                                      HGVS:
                                      20.

                                      rs780561295 [Homo sapiens]
                                        Variant type:
                                        SNV
                                        Alleles:
                                        C>A [Show Flanks]
                                        Chromosome:
                                        15:28387704 (GRCh38)
                                        15:28632850 (GRCh37)
                                        Canonical SPDI:
                                        NC_000015.10:28387703:C:A
                                        Gene:
                                        GOLGA8F (Varview)
                                        Functional Consequence:
                                        intron_variant
                                        Validated:
                                        by frequency,by alfa,by cluster
                                        MAF:
                                        A=0./0 (ALFA)
                                        A=0.000008/2 (GnomAD_exomes)
                                        A=0.000017/2 (ExAC)
                                        A=0.000037/5 (GnomAD)
                                        HGVS:

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Support Center